Dianthidium curvatum

(Smith, 1854) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Dianthidium

At a glance

Occurrence records710

Data sources6

Biological traits0

DNA specimens20

eDNA detections0

Sources6 archives

Databases and archives Dianthidium curvatum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility710 records↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF710 records

DNA & barcodingBOLD20 specimens

01Narrative

Dianthidium curvatum is a species of bee in the family Megachilidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dianthidium curvatum has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.35%

Haplotypes2

BIN1

Most divergent pair0.61%

Where individuals differ — all 10 variable positions, in barcode order

16Cmostly conserved

28Amostly conserved

29Amostly conserved

30Gmostly conserved

31Amostly conserved

32Gmostly conserved

34Amostly conserved

196Amostly conserved

289Amostly conserved

616Cmostly conserved

AATATTATATATAATCTTTGCTTTTTGAAGAGGAATAATTGGTTCCTCACTTAGAATAATTATTCGAATAGAATTAAGAATTCCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dianthidium subparvumsame genus4.1%Dianthidium heterulkeisame genus4.6%Dianthidium parvumsame genus4.9%Dianthidium singularesame genus6.1%Dianthidium ulkeisame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type710 records

Wild obs. + sensor128

Museum / vouchered582

Range

Area of Occupancy AOO1 256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 75≤1 km 9≤10 km 4>10 km 21

109 georeferenced · 19 without coordinates

Open the mapobservation + sensor128

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 5≤1 km 41≤10 km 75>10 km 8

129 georeferenced · 453 without coordinates

Open the institutions mapphysical evidence582

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beltsville, US	157
Wuzhou, CN	133
Colorado State Universitylocation not on record	100
US	48
Mississippi State, US	46
Montgomery, US	25
North Carolina State University Insect Museumlocation not on record	18
	13
Royal Saskatchewan Museumlocation not on record	13
WIlocation not on record	7
Universidad Católica de Manizaleslocation not on record	6
Cambridge, US	6
Awka, NG	4
Severin-McDaniel Insect Collectionlocation not on record	2
Weber State University, Bird and Mammal Collectionlocation not on record	1
University of Alabamalocation not on record	1
College Station, US	1
Denton, US	1

18 institutions · 582 of 582 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)