Dialysis rufithorax

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Xylophagidae/Dialysis

At a glance

Occurrence records394

Data sources6

Biological traits0

DNA specimens8

eDNA detections8

Sources6 archives

Databases and archives Dialysis rufithorax's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility394 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF394 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD8 specimens

01Narrative

Dialysis rufithorax is a species of fly in the family Xylophagidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dialysis rufithorax has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

214Gmostly conserved

229Tmostly conserved

412Cmostly conserved

413Gmostly conserved

433Cmostly conserved

434Gmostly conserved

466Gmostly conserved

481Tmostly conserved

484Tmostly conserved

490Tmostly conserved

493Amostly conserved

496Cmostly conserved

503Gmostly conserved

505Tmostly conserved

514Amostly conserved

516Cmostly conserved

520Tmostly conserved

556Amostly conserved

613Cmostly conserved

TTTATATTTTATTTTTGGAGCCTGATCAGGAATAGTCGGAACTTCTTTAAGAATTTTAATTCGGACAGAATTAGGCCACCCTGGGTCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.78%

Haplotypes3

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Meigenia dorsalissame order14.1%Orthocladius glabripennissame order14.4%Antocha australiensissame order15.0%Lamproscatella bimaculatasame order15.1%Myopina crassipalpissame order15.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type394 records

Wild obs. + sensor199

Museum / vouchered195

Range

Area of Occupancy AOO904 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 106≤1 km 36≤10 km 13>10 km 15

170 georeferenced · 29 without coordinates

Open the mapobservation + sensor199

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 194 without coordinates

Open the institutions mapphysical evidence195

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	187
University Park, US	5
CUlocation not on record	1
Champaign, US	1

4 institutions · 194 of 195 vouchered records shown · 1 without an institution code

09Environmental DNA8 detections

Where the DNA of Dialysis rufithorax was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 18.1–19.9

Seasonal swing summer↔winter24.4 °C

Max temp (day)23.7 °C 23.4–25.1

Min temp (night)12.9 °C 12.5–14.4

Precipitation115 mm/mo 110–115

Air humidity56.3 % 56.3–56.8

Moisture balance-22.6 mm/mo -42.1–-22.6

Vapour deficit921 Pa 902–1,020

Wind speed2.80 m/s 2.70–3.20

Cloud cover41.0 % 39.7–41.3

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)