Dialectica imperialella

(Zeller, 1847) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gracillariidae/Dialectica

At a glance

Occurrence records230

Data sources7

Biological traits2

DNA specimens10

eDNA detections10

Sources7 archives

Databases and archives Dialectica imperialella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility230 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF230 records

Environmental DNA1 datasets · 5 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

Dialectica imperialella is a moth of the family Gracillariidae. It is found from Denmark to the Pyrenees, Italy and Romania and from Great Britain to Russia and Ukraine. Mined leaves of Lathyrus niger (3b, 3b*, 3b**) Larva Adults are on wing in May and June in one generation. The larvae feed on Buglossoides purpurocaerulea, Lithospermum officinale, Pulmonaria angustifolia, Pulmonaria officinalis and Symphytum officinale. They mine the leaves of their host plant. The mine consists of a small, lower-surface spiralling corridor that soon becomes a blotch that overruns the previous corridor. Gradually, the mine becomes deeper, and finally is full depth locally. At the underside the mine is quite larger and membranous. The frass is initially deposited in strings, but later it becomes a network of thin threads. Pupation usually takes place outside of the mine.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dialectica imperialella has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections10

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.51%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 10 variable positions, in barcode order

1Gvariable

4Amostly conserved

58Amostly conserved

100Amostly conserved

181Gmostly conserved

214Amostly conserved

490Cmostly conserved

550Cvariable

625Gmostly conserved

628Amostly conserved

GACATTATATTTTATTTTTGGGATCTGAGCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAATTGAATTAGGGAATCCAAGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Manoba mesographasame order9.1%Piletocera aegimiusalissame order9.2%Dialectica pyramidotasame genus9.4%Eulepidotis emiliasame order9.4%Evergestis desertalissame order10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type230 records

Wild obs. + sensor215

Museum / vouchered15

Origin

Native91

Range

Area of Occupancy AOO440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 101≤1 km 35≤10 km 74

210 georeferenced · 5 without coordinates

Open the mapobservation + sensor215

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 4≤1 km 2≤10 km 1

7 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	3
Tilburg, NL	1
Research Collection of Peter Lichtmanneckerlocation not on record	1
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Provincia di Livornolocation not on record	1
Naturalis Biodiversity Centerlocation not on record	1
Tartu, EE	1
Nijmegen, NL	1

9 institutions · 11 of 15 vouchered records shown · 4 without an institution code

09Environmental DNA10 detections

Where the DNA of Dialectica imperialella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map5 countries0

1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 11.9–20.3

Seasonal swing summer↔winter19.3 °C

Max temp (day)22.5 °C 15.2–24.4

Min temp (night)13.8 °C 7.50–15.5

Precipitation101 mm/mo 67.2–159

Air humidity59.2 % 57.3–65.5

Moisture balance-30.9 mm/mo -67.9–34.6

Vapour deficit838 Pa 536–985

Wind speed3.10 m/s 1.70–3.70

Cloud cover35.1 % 29.0–38.1

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)