Diagramma pictum

(Thunberg, 1792) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Haemulidae/Diagramma

At a glance

Occurrence records17 853

Data sources8

Biological traits8

DNA specimens45

eDNA detections4

Sources8 archives

Databases and archives Diagramma pictum's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 593 records↗

OBISOcean Biodiversity Information System8 260 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics45 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS17 853 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD45 specimens

01Narrative

The painted sweetlips (Diagramma pictum), also known as the Australian slatey, blackall, bluey, grey sweetlips, moke, morwong, mother-in-law fish, painted blubber-lips, slate bream, slate sweetlips, smokey bream, thicklip or yellowdot sweetlips is a species of marine ray-finned fish, a sweetlips belonging to the family Haemulidae. It is widespread throughout the tropical waters of the Indo-West Pacific region.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length100 cm

Body mass6 300 g

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max170 m

Depth min1 m

Vulnerability44.59

05DNA & barcoding45 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diagramma pictum has left across the world's sequence archives.

At a glance

DNA specimens45

BINs2

Marker genes1

eDNA detections4

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 32 variable positions, in barcode order

37Gmostly conserved

40Amostly conserved

70Gmostly conserved

94Amostly conserved

133Tmostly conserved

157Amostly conserved

160Tmostly conserved

166Tmostly conserved

193Amostly conserved

202Gmostly conserved

217Amostly conserved

253Tmostly conserved

259Amostly conserved

268Tmostly conserved

271Gmostly conserved

274Cmostly conserved

340Cmostly conserved

346Gmostly conserved

388Gmostly conserved

400Amostly conserved

413Amostly conserved

430Gmostly conserved

445Tmostly conserved

502Tmostly conserved

508Amostly conserved

514Amostly conserved

550Gmostly conserved

574Gmostly conserved

601Cmostly conserved

610Tmostly conserved

613Tmostly conserved

643Cmostly conserved

CCTCTATCTAGTATTCGGTGCTTGAGCTGGAATAGTGGGAACGGCCCTAAGCCTGCTCATCCGGGCAGAGTTAAGCCAACCCGGCGCGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes14

BINs2

Most divergent pair4.6%

AsiaOceaniaAfricaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Diagramma centuriosame genus4.3%Plectorhinchus chaetodonoidessame family8.9%Plectorhinchus lessoniisame family9.0%Plectorhinchus diagrammussame family9.1%Plectorhinchus lineatussame family9.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_009856 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type17 853 records

Wild obs. + sensor15 697

Museum / vouchered1 604

Cultivated / captive434

Other118

Origin

Native1

Range

Area of Occupancy AOO11 260 km²

Depth

0–200 m sunlit6 943

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 43.7 m · max 275 m · 6 944 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 2 333≤1 km 11 896≤10 km 281>10 km 558

15 068 georeferenced · 629 without coordinates

Open the mapobservation + sensor15 697

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 92≤1 km 243≤10 km 487>10 km 74

896 georeferenced · 708 without coordinates

Open the institutions mapphysical evidence1 604

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 434

434 georeferenced

Open the mapnot free-living434

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DEWlocation not on record	210
Australian National Fish Collectionlocation not on record	116
Sydney, AU	69
Natick, US	62
Washington, US	44
Museum and Art Gallery of the Northern Territorylocation not on record	30
Paris, FR	29
Western Australian Museumlocation not on record	27
Kagoshima University Museumlocation not on record	24
South African Institute for Aquatic Biodiversitylocation not on record	16
Frankfurt am Main	9
Fisheries Research Laboratory, Mie Universitylocation not on record	9
CASlocation not on record	7
Museums Victorialocation not on record	4
Yokosuka City Museumlocation not on record	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
Mutare Museumlocation not on record	3
FishBaselocation not on record	2
Cincinnati, US	2
University of California San Diegolocation not on record	2
Stockholm, SE	2
Toronto, CA	1
SNSB-Zoologische Staatssammlung Münchenlocation not on record	1
	1
Helsinki, FI	1
Curtin Universitylocation not on record	1
Cambridge, US	1
ICM-CSIClocation not on record	1
Louisiana State University, Museum of Zoologylocation not on record	1
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	1
South Kensington, GB	1
Chicago, US	1

32 institutions · 684 of 1 604 vouchered records shown · 38 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Diagramma pictum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.2 °C 27.2–27.2

Seasonal swing summer↔winter2.30 °C

Max temp (day)28.6 °C

Min temp (night)25.5 °C

Precipitation26.7 mm/mo

Air humidity60.5 %

Vapour deficit1,423 Pa

Cloud cover8.70 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Diagramma pictum

At a glance

Sources8 archives

Size & morphology2

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type17 853 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 32 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type17 853 records