Dexiosoma caninum

(Fabricius, 1781) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Dexiosoma

At a glance

Occurrence records5 724

Data sources7

Biological traits0

DNA specimens18

eDNA detections215

Sources7 archives

Databases and archives Dexiosoma caninum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 724 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI215 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 724 records

Environmental DNA3 datasets · 5 countries215 detections

DNA & barcodingBOLD18 specimens

Genome at a glanceGoaT≈517 Mbp

01Narrative

Dexiosoma caninum is a European species of fly in the family Tachinidae. In the United Kingdom, the species can most commonly be found during the summer in the south of England.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dexiosoma caninum has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections215

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.09%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 2 variable positions, in barcode order

31Tmostly conserved

646Cvariable

AATTTTATATTTTATTTTTGGTGCTTGATCTGGAATAATTGGTACATCATTAAGAATTTTAATCCGAACAGAATTGAGTCATCCTGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Microphthalma disjunctasame family9.6%Trichoprosopus durvilleisame family9.7%Trichoceronia thermitanasame family10.0%Microphthalma europaeasame family10.4%Helina troenesame order10.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Dexiosoma caninum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈517 069 627 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dexiosoma caninum0.52 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.9% BUSCO

08Occurrence & distribution

Record type5 724 records

Wild obs. + sensor5 316

Museum / vouchered397

Other11

Range

Area of Occupancy AOO11 912 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 2 740≤1 km 1 037≤10 km 1 153>10 km 49

4 979 georeferenced · 337 without coordinates

Open the mapobservation + sensor5 316

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 199≤1 km 100≤10 km 52

351 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence397

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	43
NHMOlocation not on record	43
Helsinki, FI	29
Gothenburg, SE	25
SLU Artdatabankenlocation not on record	24
NCMGlocation not on record	15
University of Tokyo, Department of Zoologylocation not on record	15
ZMAAlocation not on record	12
neflocation not on record	8
CBDClocation not on record	7
South Kensington, GB	7
Tilburg, NL	6
Iwate Prefectural Museumlocation not on record	4
DFFW2018location not on record	3
DFlocation not on record	3
Philadelphia, US	3
Metsähallituslocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
Natural History Museum, Londonlocation not on record	2
DFFW2016location not on record	2
Provincia di Livornolocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Copenhagen, DK	1
BioFokuslocation not on record	1

24 institutions · 259 of 397 vouchered records shown · 138 without an institution code

09Environmental DNA215 detections

Where the DNA of Dexiosoma caninum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found215

Studies independent surveys3

Countries5

Verifiable raw sequence linked201

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 215 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 11.8–17.2

Seasonal swing summer↔winter18.3 °C

Max temp (day)19.5 °C 15.0–20.8

Min temp (night)12.2 °C 9.20–13.8

Precipitation67.9 mm/mo 54.7–97.6

Air humidity62.2 % 60.7–63.8

Moisture balance-6.20 mm/mo -55.0–20.0

Vapour deficit693 Pa 489–772

Wind speed3.10 m/s 2.50–4.20

Cloud cover47.3 % 42.9–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 215 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dexiosoma caninum

At a glance

Sources7 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 724 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 724 records