Dexia rustica

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Dexia

At a glance

Occurrence records1 829

Data sources7

Biological traits0

DNA specimens5

eDNA detections8

Sources7 archives

Databases and archives Dexia rustica's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 829 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 829 records

Environmental DNA3 datasets · 2 countries8 detections

DNA & barcodingBOLD5 specimens

01Narrative

Dexia rustica is a species of fly in the family Tachinidae.Biolib

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dexia rustica has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections8

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACTTTATATTTTATTTTCGGAACATGATCAGGAATACTAGGAACCTCTTTAAGTATTCTAATTCGAACTGAATTAGGACATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dexia vacuasame genus11.2%Winthemia erythrurasame family12.5%Winthemia sinuatasame family12.5%Mydaea nebulosasame order12.6%Rondania fasciatasame family12.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 829 records

Wild obs. + sensor1 794

Museum / vouchered23

Other12

Range

Area of Occupancy AOO3 536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy34% within 1 km

≤100 m 388≤1 km 98≤10 km 941>10 km 23

1 450 georeferenced · 344 without coordinates

Open the mapobservation + sensor1 794

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 5≤1 km 4≤10 km 1

10 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Gothenburg, SE	4
South Kensington, GB	3
Natural History Museum, Londonlocation not on record	2
MZLUlocation not on record	2
SLU Artdatabankenlocation not on record	2
CIBIOlocation not on record	1
CBDClocation not on record	1
NCMGlocation not on record	1

8 institutions · 16 of 23 vouchered records shown · 7 without an institution code

09Environmental DNA8 detections

Where the DNA of Dexia rustica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys3

Countries2

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.0 °C 16.5–17.4

Seasonal swing summer↔winter17.5 °C

Max temp (day)20.9 °C 19.5–22.4

Min temp (night)13.0 °C 12.2–13.2

Precipitation103 mm/mo 58.6–103

Air humidity60.8 % 58.2–61.2

Moisture balance-27.3 mm/mo

Vapour deficit762 Pa 733–835

Wind speed3.60 m/s

Cloud cover50.5 % 38.8–50.5

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dexia rustica

At a glance

Sources7 archives

At a glance

Record type1 829 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 829 records