Desmos wardianus

(F.M.Bailey) Jessup · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Annonaceae/Desmos

At a glance

Occurrence records254

Data sources6

Biological traits25

DNA specimens3

eDNA detections3

Sources6 archives

Databases and archives Desmos wardianus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility254 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF254 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Desmos wardianus (F.M.Bailey) Jessup – gatunek rośliny z rodziny flaszowcowatych. Występuje endemicznie w północnej Australiiw stanie Queensland oraz Terytorium Północnym.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology9

Fruit length27.5 mm

Fruit width5 mm

Leaf length57.5 mm

Leaf width25 mm

Petiole length0.4 cm

Plant height max10 m

Plant height min1 m

Seed length6.5 mm

Seed width4.9 mm

Life cycle & reproduction5

Flowering timeyyynnnnnnnny

Life formliana

Life spanperennial

Resprouting capacitypartial_resprouting

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: climber_woody shrub

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate narrowly_elliptical narrowly_oblong narrowly_obovate oblanceolate oblong

Woodinessnon-woody+woody

⚠ sources differ — AusTraits: herbaceous woody · GIFT: woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Desmos wardianus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX786521.1 ↗636 bp

ACGT

CCCTTTCCTCCCCCTCCCGCCGCCGCGGCACCGGCGCGAGGCCGGGCGCGGCGGGCGACCGACCCACAGGGCGCGAGTGGCGCCAAGGAA …

Desmos wardianus voucher BRI:Sankowsky 2664 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type254 records

Wild obs. + sensor117

Museum / vouchered133

Other4

Origin

Native12

Range

Area of Occupancy AOO648 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 6≤1 km 1

7 georeferenced · 110 without coordinates

Open the mapobservation + sensor117

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 17≤1 km 23≤10 km 64>10 km 8

112 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence133

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Palmerston, AU	41
Brisbane, AU	34
Smithfield, AU	22
Canberra, AU	17
Museo Entomologico de Leonlocation not on record	7
John T. Waterhouse Herbariumlocation not on record	3
Mount Annan, AU	2
Kensington, AU	1
Adelaide, AU	1

9 institutions · 128 of 133 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Desmos wardianus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)