Desmos polycarpus

Jessup · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Magnoliales/Annonaceae/Desmos

At a glance

Occurrence records40

Data sources6

Biological traits16

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Desmos polycarpus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility40 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources16 traits

Occurrence & distributionGBIF40 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Desmos polycarpus Jessup – gatunek rośliny z rodziny flaszowcowatych. Występuje endemicznie w północno-wschodniej części Australii – w stanie Queensland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraits

Size & morphology5

Leaf length100 mm

Leaf width30 mm

Petiole length0.6 cm

Seed length8 mm

Seed width5.75 mm

Life cycle & reproduction4

Flowering timeyynnnnnnnnyy

Life formliana

Life spanperennial

Sex typetrioecious

Habitat & environment7

Climatewet tropical

Fruit fleshinessfleshy

Fruit typeberry

Growth formclimber_woody shrub

Leaf compoundnesssimple

Leaf shapelanceolate narrowly_ovate

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Desmos polycarpus has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLKF496673.1 ↗482 bp

ACGT

CTAAAGCAAGTGTTGGATTCAAAGCCGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATATGAAACCAAAGATACTGATATCT …

Desmos polycarpus isolate AA_H01 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type40 records

Wild obs. + sensor2

Museum / vouchered36

Other2

Origin

Native1

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 5≤1 km 2≤10 km 14>10 km 2

23 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	17
Smithfield, AU	14
Canberra, AU	2
Mount Annan, AU	1
Museo Entomologico de Leonlocation not on record	1

5 institutions · 35 of 36 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Desmos polycarpus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)