Desmodium tortuosum
(Sw.) DC. · speciesAt a glance
Occurrence records4 880
Data sources12
Biological traits123
DNA specimens10
eDNA detections8
Sources12 archives
Databases and archives Desmodium tortuosum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 880 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics10 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources123 traits
Chemical compositionLOTUS · NPASS36 compounds
Occurrence & distributionGBIF4 880 records
Environmental DNA1 datasets · 4 countries8 detections
DNA & barcodingBOLD · NCBI10 specimens
Genome at a glanceCCDB · GIFT2n = 22
01Narrative
Desmodium tortuosum, le sainfoin tortueux, est une espèce de plantes à fleurs dicotylédones de la famille des Fabaceae, sous-famille des Faboideae, originaire des régions tropicales d'Amérique. C'est une plante herbacée ou un arbrisseau, annuelle ou vivace au port dressé, très ramifié pouvant atteindre 2 mètres de haut, aux feuilles trifoliées. L'espèce a été introduite dans toutes les régions tropicales du monde et est parfois considérée comme envahissante. Elle est parfois cultivée comme plante fourragère, engrais vert ou couvert végétal.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology20
Fruit length19 mm
Fruit length max30 mm
Fruit length min20 mm
Fruit width3.5 mm
Fruit width max3.5 mm
Fruit width min3 mm
Leaf length38 mm
Leaf length max100 mm
Leaf length min30 mm
Leaf width18 mm
Leaf width max50 mm
Leaf width min15 mm
Plant height2.1 m
⚠ sources differ — GIFT: 2.1 m · AusTraits: 3 m · USDA: 2.74 m · TRY: 2.74 m
Plant height max2 m
Plant height min0 m
Seed length2.4 mm
Seed mass2.77 mg
⚠ sources differ — TRY: 2.77 mg · GIFT: 2.55 mg
Seed mass max3.75 mg
Seed mass min2.27 mg
Seed width1.65 mm
Life cycle & reproduction29
Bloom periodSummer
Coppice potentialNo
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typeanimal
Flower colourblue
Flower conspicuousYes
Flowering timeyyyynnnnnyyy
Fruit seed period beginFall
Fruit seed period endWinter
Growth rate USDARapid
Life formannual, perennial or subshrub
Life spanannual/perennial
⚠ sources differ — TRY: annual/perennial · AusTraits: annual biennial perennial · GIFT: perennial
Lifespan categoryModerate
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Resprout abilityNo
Seed spread rateRapid
Seedling vigorHigh
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment32
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatLow
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 000 m
Elevation mean1 600 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage textureMedium
Fruit colourbrown
Fruit fleshinessdry
Fruit typelegume
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: shrub · TRY: Herb
Growth form USDASingle Crown
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campo Limpo, Carrasco, Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Restinga, Vegetação Sobre Afloramentos Rochosos
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesscompound
Leaf retentionNo
Leaf shapeelliptical lanceolate narrowly_elliptical rhomboidal
Low growing grassNo
Root depth min6 in
Shape and orientationErect
Small grainNo
Succulenceno
Woodinessvariable
⚠ sources differ — TRY: non-woody/woody · AusTraits: herbaceous woody · GIFT: non-woody
Physiology & chemistry22
Anaerobic toleranceNone
C:N ratioLow
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementLow
Fire resistantNo
Fire toleranceLow
Frost free days min120 days
Leaf n34.57 mg/g
Moisture useLow
Nitrogen fixation levelLow
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Precipitation max80 in
Precipitation min20 in
Salinity toleranceNone
Shade toleranceHigh
Soil pH max7.2 pH
Soil pH min5 pH
Specific leaf area (SLA)34.62 mm²/mg
Temperature min17 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound200 640 per lb
ToxicityNone
Veneer productNo
Other traits4
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceYes
03Chemical composition36 compounds
Compounds documented for Desmodium tortuosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavones10
Chalcones9
Cycloartane triterpenoids3
Cycloartane triterpenoids $ Lanostane, Tirucallane and Euphane triterpenoids2
Flavanones2
Documented compounds36 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,3R,6S,8S,11R,12S,15R,16R)-7,7,12,16-tetramethyl-15-[(2S)-6-methylhept-5-en-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol | present | NPASS | |
| (1S,3R,8S,11S,12S,15R,16R)-7,7,12,16-tetramethyl-15-[(2R)-6-methylhept-5-en-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-one | present | NPASS | |
| (2R)-2-[3-[(2E)-3,7-dimethylocta-2,6-dienyl]-4-hydroxyphenyl]-5,7-dihydroxy-2,3-dihydrochromen-4-one | present | NPASS | |
| (2S)-7,4'-Dihydroxy-8-geranylflavanone | present | NPASS | |
| (5aS)-1,3,8-Trihydroxy-5,5,11,11-tetramethyl-5a,6-dihydro-5H,7H,11H-[1]benzofuro[3,4-bc]pyrano[3,2-h]xanthen-7-one | present | NPASS | |
| (E)-1-[(2R,3R)-3,5-dihydroxy-2-methyl-2-(4-methylpent-3-enyl)-3,4-dihydrochromen-6-yl]-3-(4-hydroxyphenyl)prop-2-en-1-one | present | NPASS | |
| (E)-1-[(2S)-5-hydroxy-2-methyl-2-(4-methylpent-3-enyl)chromen-6-yl]-3-(4-hydroxyphenyl)prop-2-en-1-one | present | NPASS | |
| (E)-1-[2,4-dihydroxy-3-[(2E,5S)-5-methoxy-3,7-dimethylocta-2,6-dienyl]phenyl]-3-(4-hydroxyphenyl)prop-2-en-1-one | present | NPASS | |
| (E)-1-[2,4-dihydroxy-3-[(2E,6R)-6-hydroxy-3,7-dimethylocta-2,7-dienyl]phenyl]-3-(3,4-dihydroxyphenyl)prop-2-en-1-one | present | NPASS | |
| (E)-1-[2,4-dihydroxy-3-[(2E,6R)-6-hydroxy-3,7-dimethylocta-2,7-dienyl]phenyl]-3-(4-hydroxyphenyl)prop-2-en-1-one | present | NPASS |
05DNA & barcoding10 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Desmodium tortuosum has left across the world's sequence archives.
At a glance
DNA specimens10
Marker genes4
GenBank sequences10
eDNA detections8
Countries4
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCATTAGGCCGAGGGCATGCCTGCCTGGGTGTCACACATC …
Desmodium tortuosum voucher MIB:SASS 0071 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL4★rbcLa★ITS3
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT
The complete instruction manual Desmodium tortuosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 22 n = 11
Ploidydiploid inferred
Chromosome records22–222n range22median22mode8records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 228×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · eflora +2
CCDB · ipcn-api-dl — Renard, R., J. Lambinon, M. Reekmans, P. v. Veken & M. Govaert. 1983. Nombres chromosomiques de quelques Angiospermes du Rwanda, du Burundi et du Kenya. Bull. Jard. Bot. Nat. Belg. 53: 342–371.
CCDB · ipcn-api-dl — Vanni, R. 1983. Recuentos cromosómicos en Hedysareae (Leguminosae-Papilionoideae). 5: 227–233.
CCDB · ipcn-api-dl — Kumar, M. G. V. & P. I. Kuriachan. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 145–147.
CCDB · ipcn-api-dl — Chen, Z. y., T. c. Chen & X. x. Huang. 1991. Chromosome counts on the Chinese Leguminosae. Acta Bot. Austro Sin. 7: 26–39, pl.1.
CCDB · book-ipcn67-71 — ROTAR, P.P., & u. URATA. 1967. Cytological studies in the genus Desmodium; some chromosome counts. Amer. J. Bot. 54: 1-4.
CCDB · eflora
CCDB · book-atlas-flowering-plants — FoH
GIFT · GIFT (floras)
n 111×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Kumar, M. G. V. & P. I. Kuriachan. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 145–147.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type4 880 records
Wild obs. + sensor1 953
Museum / vouchered2 578
Cultivated / captive21
Other328
Origin
Native186
Introduced19
Range
Area of Occupancy AOO12 180 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy90% within 1 km
≤100 m 1 058≤1 km 112≤10 km 51>10 km 75
1 296 georeferenced · 657 without coordinates
Open the mapobservation + sensor1 953
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy68% within 1 km
≤100 m 627≤1 km 65≤10 km 246>10 km 80
1 018 georeferenced · 1 560 without coordinates
Open the institutions mapphysical evidence2 578
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2
2 georeferenced · 19 without coordinates
Open the mapnot free-living21
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions119 of 243 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 287 |
| Saint Louis, US | 217 |
| Mexico City, MX | 166 |
| Brisbane, AU | 132 |
| Bronx, US | 75 |
| Mérida, MX | 71 |
| Palmerston, AU | 65 |
| Tampa, US | 58 |
| Kew, GB | 54 |
| Jena Microbial Resource Collectionlocation not on record | 42 |
| MeiseBGlocation not on record | 41 |
| Austin, US | 35 |
| Ann Arbor, US | 35 |
| Canberra, AU | 32 |
| Smithfield, AU | 31 |
| HNBlocation not on record | 29 |
| Tapachula, MX | 28 |
| Flagstaff, US | 24 |
| UFMSlocation not on record | 24 |
| Riverside, US | 24 |
| Miami, US | 22 |
| Pretoria, ZA | 21 |
| University of Stellenboschlocation not on record | 21 |
| CASlocation not on record | 20 |
| Blumenau, BR | 20 |
| Laboratorio de Ictiologialocation not on record | 20 |
| Museo Entomologico de Leonlocation not on record | 19 |
| Universidad de Caldas (UCaldas)location not on record | 17 |
| Xiamen, CN | 16 |
| Paris, FR | 15 |
| Chapingo, MX | 15 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 15 |
| Valdosta State Universitylocation not on record | 14 |
| Universidad Nacional de Colombia (UNAL)location not on record | 14 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 14 |
| Antiguo Cuscatlán, SV | 14 |
| Corrientes, AR | 14 |
| Columbia, US | 13 |
| LDlocation not on record | 13 |
| Mount Annan, AU | 13 |
| Adam Mickiewicz University in Poznańlocation not on record | 13 |
| San Isidro, AR | 12 |
| Aarhus, DK | 12 |
| UEMlocation not on record | 12 |
| UNICAMPlocation not on record | 11 |
| LSF/FSA/UAClocation not on record | 11 |
| Zacatecas, MX | 11 |
| Porto Alegre, BR | 10 |
| Foz do Iguaçu, BR | 10 |
| Mexico City, MX | 10 |
| JBRJlocation not on record | 10 |
| Kensington, AU | 10 |
| Masindi, UG | 9 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 9 |
| Bangkok, TH | 9 |
| UNESP-ISlocation not on record | 9 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 8 |
| Tuscaloosa, US | 7 |
| Ciudad de México, MX | 7 |
| Castelar, AR | 7 |
| Tlalnepantla, MX | 7 |
| Mississippi State, US | 7 |
| UnBlocation not on record | 7 |
| Brasília, BR | 7 |
| Frankfurt am Main | 7 |
| UNIVASFlocation not on record | 7 |
| Cenargenlocation not on record | 7 |
| Université du Lomélocation not on record | 7 |
| AUAlocation not on record | 7 |
| Mérida, MX | 6 |
| University of Southern Mississippilocation not on record | 6 |
| San Francisco de Campeche, MX | 6 |
| Universidade Federal de Sergipe (UFS)location not on record | 6 |
| Leiden University Medical Centerlocation not on record | 6 |
| Berlin, DE | 6 |
| TAIElocation not on record | 6 |
| GAlocation not on record | 6 |
| Bloomington, US | 6 |
| Wuzhou, CN | 6 |
| Universidade Federal do Vale do São Franciscolocation not on record | 5 |
| Universidade Federale do Rio Grande do Sullocation not on record | 5 |
| León, NI | 5 |
| UFSClocation not on record | 5 |
| Universidad del Valle (UniValle)location not on record | 5 |
| Universidad de Antioquia (UdeA)location not on record | 5 |
| James Cook Townsvillelocation not on record | 5 |
| ASUlocation not on record | 5 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 5 |
| Phoenix, US | 5 |
| Austin, US | 5 |
| Altos de Pipe, VE | 5 |
| Adelaide, AU | 5 |
| Culiacán, MX | 5 |
| Campo Mourão, BR | 4 |
| Autlán de Navarro, MX | 4 |
| UTFPR-DVlocation not on record | 4 |
| Honolulu, US | 4 |
| Hanshan Normal Universitylocation not on record | 4 |
| UTFPR-CPlocation not on record | 4 |
| Maringá, BR | 4 |
| US | 4 |
| EL PASO, US | 4 |
| Fundación Miguel Lillolocation not on record | 4 |
| Giardini Botanici Hanburylocation not on record | 4 |
| Tall Timbers Research Stationlocation not on record | 4 |
| Guasave, MX | 4 |
| Stockholm, SE | 4 |
| Fort Worth, US | 4 |
| CEPLAClocation not on record | 4 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 4 |
| San Diego, US | 4 |
| UNESP-FCAlocation not on record | 3 |
| Clemson, US | 3 |
| Chongqing Museumlocation not on record | 3 |
| Puebla, MX | 3 |
| Chicago, US | 3 |
| BISHlocation not on record | 3 |
| Shenzhen, CN | 3 |
| Auckland, NZ | 3 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 3 |
| Guangzhou, CN | 3 |
| Chapel Hill, US | 3 |
| LSFlocation not on record | 3 |
| INMAlocation not on record | 3 |
| Taipei, TW | 3 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Feira de Santana, BR | 2 |
| Universidad de Guayaquillocation not on record | 2 |
| MEXUlocation not on record | 2 |
| UNESP-RClocation not on record | 2 |
| UFRPElocation not on record | 2 |
| Durban, ZA | 2 |
| Université de Bordeauxlocation not on record | 2 |
| LBVlocation not on record | 2 |
| Montréal, CA | 2 |
| FUVATESlocation not on record | 2 |
| Ivano-Frankivsk, UA | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record | 2 |
| Herbier National du Gabonlocation not on record | 2 |
| Yaoundé, CM | 2 |
| St. Augustine, TT | 2 |
| Glocation not on record | 2 |
| Juriquilla, MX | 2 |
| Paleontological Collectionlocation not on record | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| Jackson, US | 2 |
| Madison, US | 2 |
| Sociedad Para el Estudio de los Recursos Bioticos de Oaxacalocation not on record | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Instituto de Investigação Científica Tropicallocation not on record | 2 |
| CJBGlocation not on record | 2 |
| Station d'Ecologie de Lamtolocation not on record | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Universidade Federal do Espírito Santolocation not on record | 2 |
| USP-IBlocation not on record | 2 |
| Santa Teresa, BR | 2 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 2 |
| FUNEDlocation not on record | 2 |
| Salvador, BR | 2 |
| Christchurch, NZ | 2 |
| Wlocation not on record | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| Londrina, BR | 1 |
| INIREBlocation not on record | 1 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Calabar, NG | 1 |
| Sangmiung Universitylocation not on record | 1 |
| Clocation not on record | 1 |
| Williamsburg, US | 1 |
| Minia, EG | 1 |
| La Paz, MX | 1 |
| Ensenada, MX | 1 |
| UDESC-CAVlocation not on record | 1 |
| UNESClocation not on record | 1 |
| Criciúma, BR | 1 |
| Jataí / Setor Industrial, BR | 1 |
| UFPIlocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| MSB-3054location not on record | 1 |
| South Kensington, GB | 1 |
| Armidale, AU | 1 |
| Philadelphia, US | 1 |
| UFMGlocation not on record | 1 |
| NO DISPONIBLElocation not on record | 1 |
| DSMlocation not on record | 1 |
| Centre National des Semences Forestièreslocation not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Universidad Nacional Agrarialocation not on record | 1 |
| Toronto, CA | 1 |
| Hermosillo, MX | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
| UTPLlocation not on record | 1 |
| Tomioka, JP | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Burlington, US | 1 |
| Arcata, US | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| Monastir, TN | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Australian Tropical Herbariumlocation not on record | 1 |
| UNITINSlocation not on record | 1 |
| Davis, US | 1 |
| Uppsala, SE | 1 |
| SCAUlocation not on record | 1 |
| Brasília, BR | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| Due West, US | 1 |
| CNF-UFHBlocation not on record | 1 |
| Norfolk, US | 1 |
| Institut Botanique Ake-Assi d'Andokoilocation not on record | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| Boise, US | 1 |
| Göteborg, SE | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Kochi, JP | 1 |
| Wellington, NZ | 1 |
| Universidad de los Llanos (UniLlanos)location not on record | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| UFBAlocation not on record | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| Lake Charles, US | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| Hobart, AU | 1 |
| San José, CR | 1 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| Loja, EC | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| Provo, US | 1 |
| Universidade Tecnológica Federal do Paranálocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| Museo Athanasius Kircher di Romalocation not on record | 1 |
| Millersville, US | 1 |
| Tempe, US | 1 |
| Cambridge, US | 1 |
243 institutions · 2 458 of 2 578 vouchered records shown · 117 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA8 detections
Where the DNA of Desmodium tortuosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found8
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 8 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.5 °C 23.8–27.6
Seasonal swing summer↔winter6.20 °C
Max temp (day)28.6 °C 27.7–29.8
Min temp (night)23.1 °C 18.8–25.4
Precipitation60.9 mm/mo 14.4–429
Air humidity62.3 % 54.4–66.4
Moisture balance95.7 mm/mo
Vapour deficit1,278 Pa 1,112–1,425
Wind speed3.30 m/s
Cloud cover34.2 % 24.9–54.1
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.