Desmanthus virgatus
(L.) Willd. · speciesAt a glance
Occurrence records4 528
Data sources13
Biological traits125
DNA specimens7
eDNA detections7
Sources13 archives
Databases and archives Desmanthus virgatus's data was compiled from.
WikipediaWikimedia Foundation5 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 476 records↗
OBISOcean Biodiversity Information System52 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics7 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources125 traits
Occurrence & distributionGBIF · OBIS4 528 records
Environmental DNA2 datasets · 3 countries7 detections
DNA & barcodingBOLD · NCBI7 specimens
Genome at a glanceCCDB2n = 28
01Narrative
Desmanthus virgatus is a species of flowering plant in the legume family that is known by many common names, including wild tantan, prostrate bundleflower, dwarf koa, desmanto, acacia courant, acacia savane, pompon blank,Francis, J. K., Ed. Desmanthus virgatus. Wildland Shrubs of the United States and its Territories - Thamnic Descriptions. USDA Forest Service. International Institute of Tropical Forestry and Shrub Sciences Laboratory. adormidera, brusca prieta, frijolillo, ground tamarind, guajillo, guashillo, huarangillo, langalet, petit acacia, petit cassie, petit mimosa, virgate mimosa,Cook, B.G., et al. 2005. Desmanthus virgatus. Tropical Forages: An Interactive Selection Tool. and slender mimosa,Desmanthus virgatus. USDA Forest Service. Pacific Island Ecosystems at Risk (PIER). as well as simply desmanthus. It is native to the American tropics and subtropics but is present elsewhere as an introduced species. In some areas it is cultivated as a fodder and forage crop.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology23
Fruit length50 mm
Fruit length max90 mm
Fruit length min50 mm
Fruit width max4 mm
Fruit width min3 mm
Leaf length6.25 mm
Leaf length max9 mm
Leaf length min2 mm
Leaf width2.5 mm
Leaf width max3 mm
Leaf width min1 mm
Petiole length0.5 cm
Plant height0.61 m
⚠ sources differ — GIFT: 0.61 m · AusTraits: 2 m · USDA: 0.61 m · TRY: 0.61 m
Plant height max3 m
Plant height min0.5 m
Seed length2.75 mm
Seed mass4.83 mg
⚠ sources differ — TRY: 4.83 mg · GIFT: 5.63 mg
Seed mass max11.97 mg
Seed mass min2.47 mg
Seed volume4.1 mm³
Seed volume max4.1 mm³
Seed volume min4.1 mm³
Seed width1.75 mm
Life cycle & reproduction28
After harvest regrowth rateModerate
Bloom periodIndeterminate
Coppice potentialNo
Dehiscencedehiscent
Flower colourwhite
Flower conspicuousNo
Flowering endApr
Flowering startJan
Fruit seed period beginYear Round
Fruit seed period endYear Round
Growth rate USDASlow
Life formperennial or shrub
Life spanperennial
Lifespan categoryModerate
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formchamaephyte
Resprout abilityYes
Seed spread rateModerate
Seedling vigorHigh
Vegetative spread rateSlow
Diet & foraging1
Parasiteindependent
Habitat & environment31
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 200 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorYellow-Green
Foliage porosity summerDense
Foliage porosity winterDense
Foliage textureFine
Fruit colourbrown
Fruit typelegume
Growth formshrub
⚠ sources differ — GIFT: shrub · AusTraits: shrub subshrub · TRY: Herb
Growth form USDAMultiple Stem
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Cerrado (lato sensu)
Hedge toleranceLow
Known allelopathNo
Leaf compoundnesscompound
Leaf formlinear
Leaf retentionYes
Leaf shapelanceolate linear
Low growing grassNo
Root depth min24 in
Shape and orientationSemi-Erect
Small grainNo
Woodinessvariable
⚠ sources differ — TRY: non-woody/woody · AusTraits: woody · GIFT: non-woody
Physiology & chemistry19
Anaerobic toleranceLow
C:N ratioLow
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementMedium
Fire resistantNo
Fire toleranceLow
Frost free days min365 days
Moisture useLow
Nitrogen fixation levelMedium
Photosynthetic pathwayC3
Precipitation max80 in
Precipitation min30 in
Salinity toleranceMedium
Shade toleranceLow
Soil pH max8 pH
Soil pH min5 pH
Temperature min17 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound340 000 per lb
ToxicityNone
Veneer productNo
Other traits8
Fall conspicuousYes
Fruit seed abundanceLow
Fruit seed conspicuousYes
Fruit seed persistenceYes
Planting density max1 200 per acre
Planting density min700 per acre
Seeds per fruit11-100
Shoot orientationerect
05DNA & barcoding7 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Desmanthus virgatus has left across the world's sequence archives.
At a glance
DNA specimens7
Marker genes5
GenBank sequences7
eDNA detections7
Countries3
The DNA barcodea real sequence read deposited for this species
TTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAACGTCGCCACCGCCCCCGCCCGGGGCGT …
Desmanthus virgatus isolate DEVI_P.C_1of3 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL1★rbcLa★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Desmanthus virgatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidypolyploid inferred
Chromosome records28–282n range28median28mode2records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 282×CCDB · ipcn-api-dl · CCDB · book-indian_vol1
CCDB · ipcn-api-dl — Kappali, S. A. & B. C. Patil. 1987. Chromosome Number Reports 95. Taxon 36: 493.
CCDB · book-indian_vol1 — Turner, B.L. & Beaman, J.H. 1953 ; Gadella, T.W.J. & KJiphuis, E. 1964
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type4 528 records
Wild obs. + sensor1 746
Museum / vouchered2 457
Cultivated / captive44
Other281
Origin
Native454
Introduced4
Range
Area of Occupancy AOO8 392 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy24% within 1 km
≤100 m 249≤1 km 108≤10 km 840>10 km 269
1 466 georeferenced · 280 without coordinates
Open the mapobservation + sensor1 746
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy76% within 1 km
≤100 m 394≤1 km 60≤10 km 105>10 km 37
596 georeferenced · 1 861 without coordinates
Open the institutions mapphysical evidence2 457
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 44 records without
Open the mapnot free-living44
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions108 of 204 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 212 |
| Saint Louis, US | 179 |
| Masindi, UG | 165 |
| Bronx, US | 138 |
| Mexico City, MX | 116 |
| Austin, US | 111 |
| Kew, GB | 63 |
| Mérida, MX | 57 |
| Puerto Ayora, EC | 52 |
| San Isidro, AR | 41 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 36 |
| Tapachula, MX | 34 |
| Porto Alegre, BR | 30 |
| Laboratorio de Ictiologialocation not on record | 29 |
| Salvador, BR | 28 |
| UNIVASFlocation not on record | 27 |
| Texas Lutheran Universitylocation not on record | 27 |
| Altos de Pipe, VE | 24 |
| University of Stellenboschlocation not on record | 24 |
| Corrientes, AR | 23 |
| Feira de Santana, BR | 22 |
| National Biodiversity Institute, Costa Ricalocation not on record | 21 |
| UFMSlocation not on record | 21 |
| Tampa, US | 20 |
| Miami, US | 18 |
| Chaguaramas, TT | 18 |
| Culiacán, MX | 18 |
| Chicago, US | 18 |
| LDlocation not on record | 17 |
| Museo Entomologico de Leonlocation not on record | 16 |
| JBRJlocation not on record | 16 |
| UFERSAlocation not on record | 15 |
| Flagstaff, US | 15 |
| UFRPElocation not on record | 14 |
| Xiamen, CN | 14 |
| CEPLAClocation not on record | 13 |
| Mérida, MX | 13 |
| UFBAlocation not on record | 13 |
| Departamento de Sistematica e Ecologialocation not on record | 13 |
| Paris, FR | 12 |
| Universidad de Antioquia (UdeA)location not on record | 12 |
| Tlalnepantla, MX | 11 |
| Canberra, AU | 11 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 11 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 11 |
| TAIElocation not on record | 11 |
| Cenargenlocation not on record | 11 |
| Universidade Federal de Sergipe (UFS)location not on record | 10 |
| Antiguo Cuscatlán, SV | 10 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 9 |
| Taipei, TW | 9 |
| Nishihara, JP | 9 |
| Brasília, BR | 9 |
| Aarhus, DK | 8 |
| Ann Arbor, US | 8 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 8 |
| León, NI | 8 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 8 |
| Fortaleza, BR | 8 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 7 |
| Chapingo, MX | 7 |
| Córdoba, AR | 7 |
| Castelar, AR | 7 |
| Universidad Nacional de Colombia (UNAL)location not on record | 7 |
| Paleontological Collectionlocation not on record | 7 |
| Istituto Agrario Castelnuovolocation not on record | 7 |
| ASUlocation not on record | 6 |
| Odawara, JP | 6 |
| EL PASO, US | 6 |
| Jena Microbial Resource Collectionlocation not on record | 6 |
| Riverside, US | 6 |
| Université de Strasbourglocation not on record | 6 |
| Durban, ZA | 5 |
| Mexico City, MX | 5 |
| Moscow State Universitylocation not on record | 5 |
| Fort Worth, US | 5 |
| Universidad Nacional Federico Villarreallocation not on record | 5 |
| Universidade Federal do Vale do São Franciscolocation not on record | 5 |
| Universidade Federale do Rio Grande do Sullocation not on record | 5 |
| Berlin, DE | 5 |
| USP-IBlocation not on record | 4 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 4 |
| South Kensington, GB | 4 |
| Mount Annan, AU | 4 |
| Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record | 4 |
| Kensington, AU | 4 |
| Universidad Industrial de Santander (UIS)location not on record | 4 |
| Tuxtla Gutiérrez, MX | 4 |
| Ivano-Frankivsk, UA | 4 |
| Toronto, CA | 4 |
| Taipei, TW | 4 |
| Pretoria, ZA | 4 |
| Tuxtla Gutiérrez, MX | 4 |
| Brasília, BR | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| IPA/SPlocation not on record | 3 |
| Guasave, MX | 3 |
| UFPIlocation not on record | 3 |
| UnBlocation not on record | 3 |
| Wuzhou, CN | 3 |
| Universidad de Caldas (UCaldas)location not on record | 3 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 3 |
| Tsukuba, JP | 3 |
| Stockholm, SE | 3 |
| BISHlocation not on record | 3 |
| San José, CR | 3 |
| Giardini Botanici Hanburylocation not on record | 3 |
| Honolulu, US | 3 |
| MEXUlocation not on record | 3 |
| UFPElocation not on record | 3 |
| Juriquilla, MX | 3 |
| FUVATESlocation not on record | 2 |
| Burlington, US | 2 |
| CJBGlocation not on record | 2 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 2 |
| Universidad Nacional de Asunciónlocation not on record | 2 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 2 |
| Chengdu, CN | 2 |
| US | 2 |
| Sucre, BO | 2 |
| CPPSULlocation not on record | 2 |
| Austin, US | 2 |
| Cruz das Almas, BR | 2 |
| Ilhéus, BR | 2 |
| Montréal, CA | 2 |
| BAYLUlocation not on record | 2 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 2 |
| Museo Athanasius Kircher di Romalocation not on record | 2 |
| Londrina, BR | 2 |
| San Francisco de Campeche, MX | 2 |
| Museu Paraense Emílio Goeldilocation not on record | 2 |
| CPATSAlocation not on record | 2 |
| Sociedad Para el Estudio de los Recursos Bioticos de Oaxacalocation not on record | 2 |
| UNESP, Campus São José Rio Prêtolocation not on record | 2 |
| Claremont, US | 2 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 2 |
| Hobart, AU | 2 |
| UNICAMPlocation not on record | 2 |
| Armidale, AU | 2 |
| Santiago de Cali, CO | 2 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 2 |
| Museum of Zoologylocation not on record | 2 |
| FUNEDlocation not on record | 2 |
| Bloomington, US | 1 |
| UTFPR-CPlocation not on record | 1 |
| Universidad de Pamplona (UPamplona)location not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Universidade de São Paulolocation not on record | 1 |
| Lake Charles, US | 1 |
| Tempe, US | 1 |
| Managua, NI | 1 |
| San Diego, US | 1 |
| Universität Tübingenlocation not on record | 1 |
| Centro Cultural Santo Domingolocation not on record | 1 |
| Criciúma, BR | 1 |
| Sanda, JP | 1 |
| Chongqing Museumlocation not on record | 1 |
| OTSlocation not on record | 1 |
| Champaign, US | 1 |
| Vancouver, CA | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Angwin, US | 1 |
| Auckland, NZ | 1 |
| Ciudad de México, MX | 1 |
| Pelotas, BR | 1 |
| UFMGlocation not on record | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Maringá, BR | 1 |
| Nishihara, JP | 1 |
| UNESClocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| UDESC-CAVlocation not on record | 1 |
| Universidad Surcolombiana (USCO)location not on record | 1 |
| Philadelphia, US | 1 |
| FPMZBlocation not on record | 1 |
| Brisbane, AU | 1 |
| Phoenix, US | 1 |
| H. Balslev (AAU)location not on record | 1 |
| ESP003location not on record | 1 |
| Albuquerque, US | 1 |
| Clemson, US | 1 |
| ESALQlocation not on record | 1 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 1 |
| Bangkok, TH | 1 |
| Emporia, US | 1 |
| Kagoshima, JP | 1 |
| Smithfield, AU | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Edinburgh, GB | 1 |
| Plocation not on record | 1 |
| Barcelona, ES | 1 |
| PUC-RSlocation not on record | 1 |
| Cape Town, ZA | 1 |
| Montecillo, Texcoco, MX | 1 |
| Mexico City, MX | 1 |
| Bogotá, D.C., CO | 1 |
| UESBlocation not on record | 1 |
| Loja, EC | 1 |
| UFVJMlocation not on record | 1 |
| Indiana University Southeastlocation not on record | 1 |
204 institutions · 2 282 of 2 457 vouchered records shown · 123 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA7 detections
Where the DNA of Desmanthus virgatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found7
Studies independent surveys2
Countries3
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 7 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median21.0 °C 20.4–26.2
Seasonal swing summer↔winter12.3 °C
Max temp (day)26.8 °C 25.9–28.0
Min temp (night)16.1 °C 14.3–23.8
Precipitation167 mm/mo 81.3–186
Air humidity58.7 % 53.5–63.6
Moisture balance9.90 mm/mo -68.9–24.1
Vapour deficit1,175 Pa 1,021–1,239
Wind speed3.00 m/s 1.70–4.70
Cloud cover32.7 % 21.7–36.6
CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.