Descurainia sophia
(L.) Webb ex Prantl · speciesAt a glance
Occurrence records58 481
Data sources15
Biological traits66
DNA specimens94
eDNA detections47
Sources15 archives
Databases and archives Descurainia sophia's data was compiled from.
WikipediaWikimedia Foundation11 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility58 481 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI47 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics94 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources66 traits
Chemical compositionLOTUS · NPASS67 compounds
Occurrence & distributionGBIF58 481 records
Environmental DNA1 datasets · 7 countries47 detections
DNA & barcodingBOLD · NCBI94 specimens
Genome at a glanceCCDB · GIFT · GoaT333 Mbp
01Narrative
Descurainia sophia is a member of the family Brassicaceae. Common names include flixweed, herb-Sophia and tansy mustard. It reproduces by seeds. It is a dominant weed in dark brown prairie and black prairie soils of southern Alberta.http://www.agric.gov.ab.ca/soil/survey-reports/ab11/ab11_report.pdf Wyatt, Newton, Bowser and Odynsky, 1942. Soil Survey of Blackfoot and Calgary Sheets Its stem is erect, branched, and 4-30 in high. It was once given to patients with dysentery and called by ancient herbalists Sophia Chirurgorum, "The Wisdom of Surgeons".botanical.com - A Modern Herbal | Mustards It is the type species of the genus Descurainia (named for French botanist and herbalist François Descurain (1658–1749)) and of the rejected genus Sophia Adans.Index Nominum GenericorumTropicos
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology27
Fruit length27.5 mm
Fruit length max30 mm
Fruit length min10 mm
Fruit width1 mm
Fruit width max1 mm
Fruit width min1 mm
Leaf length50 mm
⚠ sources differ — AusTraits: 50 mm · GIFT: 70 mm
Leaf length max120 mm
Leaf length min20 mm
Leaf mass26.3 mg
Leaf size766 mm²
Leaf width20 mm
Leaf width max20 mm
Leaf width min20 mm
Plant height0.475 m
⚠ sources differ — GIFT: 0.475 m · AusTraits: 0.6 m · LEDA: 0.45 m · TRY: 0.555 m
Plant height generative0.45 m
Plant height max1 m
Plant height min0.1 m
Seed length0.97 mm
⚠ sources differ — TRY: 0.97 mm · AusTraits: 1.25 mm · GIFT: 1 mm
Seed length max1.5 mm
Seed length min0.8 mm
Seed mass0.1 mg
⚠ sources differ — TRY: 0.1 mg · LEDA: 0.1 mg · GIFT: 3.79 mg
Seed mass max0.21 mg
Seed mass min0 mg
Seed volume0.082 mm³
Seed volume max0.082 mm³
Seed volume min0.082 mm³
Life cycle & reproduction15
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flowering endAug
Flowering startMay
Life formannual or biennial
Life spanannual/biennial
⚠ sources differ — TRY: annual/biennial · AusTraits: annual biennial · LEDA: annuals · GIFT: annual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number75 650
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 900 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typesilique
⚠ sources differ — AusTraits: silique · GIFT: capsule
Growth formherb
Habitat GIFTcrop fields, inhabited places, meadows, mountains, old fields, roadsides, saline places
Leaf compoundnesssimple
Leaf shapelinear
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry6
Leaf dry-matter content (LDMC)195 mg/g
⚠ sources differ — TRY: 195 mg/g · LEDA: 181 mg/g
Leaf n46.94 mg/g
Leaf p2.54 mg/g
Photosynthetic pathwayC3
Seed longevity index1
Specific leaf area (SLA)14 mm²/mg
⚠ sources differ — TRY: 14 mm²/mg · LEDA: 26.69 mm²/mg · GIFT: 26.69 mm²/mg
Other traits2
Diaspore typeseed
Shoot orientationerect
03Chemical composition67 compounds
Compounds documented for Descurainia sophia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Flavonols12
Cinnamic acids and derivatives7
Unsaturated fatty acids6
Cardenolides3
Furofuranoid lignans3
Documented compounds67 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Syringaresinol | present | NPASS | |
| (-)-beta-Pinene | present | NPASS | |
| (-)-Syringaresinol | present | NPASS | |
| (1S,5S,6R)-6-(4-hydroxy-3,5-dimethoxyphenyl)-5-(hydroxymethyl)-8-oxabicyclo[3.2.1]oct-3-en-2-one | present | LOTUS | |
| (1S,5S,6S)-6-(4-hydroxy-3,5-dimethoxyphenyl)-5-(hydroxymethyl)-8-oxabicyclo[3.2.1]oct-3-en-2-one | present | LOTUS | |
| (2R,3S,4S,5R,6S)-2-(hydroxymethyl)-6-[(3R,25S,27R)-3,25,27-trihydroxyoctacosoxy]oxane-3,4,5-triol | present | NPASS | |
| (3E,5R)-5-(4-hydroxy-3,5-dimethoxyphenyl)-3-[(4-hydroxy-3,5-dimethoxyphenyl)methylidene]oxolan-2-one | present | LOTUS | |
| (3E,5S)-5-(4-hydroxy-3,5-dimethoxyphenyl)-3-[(4-hydroxy-3,5-dimethoxyphenyl)methylidene]oxolan-2-one | present | LOTUS | |
| (4S,5S)-4-(4-hydroxy-3,5-dimethoxyphenyl)-5-methyloxolan-2-one | present | LOTUS | |
| 1,2-(2-Propenyl)-disulfane | present | NPASS |
05DNA & barcoding94 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Descurainia sophia has left across the world's sequence archives.
At a glance
DNA specimens94
Marker genes7
GenBank sequences10
eDNA detections47
Countries7
The DNA barcodea real sequence read deposited for this species
CCAACGATCATCACTCGCGGTGGGCCGGTTTCTTAACTGATCCCGTGCTTGCCGGATCCGTGGTTTCGCGTTCTGTTCCAGTCGGGAGCT …
Descurainia sophia isolate F. Al-Dulaimi10 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL2★rbcLa★ITS7★ITS1★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Descurainia sophia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size332 520 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Descurainia sophia0.33 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy4× tetraploid · measured
Chromosome records12–282n range28median28mode81records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2865×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · fl-europaea +14
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · fl-europaea — Lbvkvist, 1963
CCDB · poland — Pogan E., Wcis?o H., Jankun A. et al. 1980 b. Further studies in chromosome numbers of Polish Angiosperms. Part XIII. Acta Biol. Cracov. Ser. Bot. 22, 37-69.
CCDB · ipcn-api-dl — Aryavand, A. 1978. Contribution a l'etude cytotaxonomique des Cruciferes de l'Iran. II. Bull. Soc. Neuchateloise Sci. Nat. 101: 95–106.
CCDB · ipcn-api-dl — Ančev, M. E. 1983. Karyology and reproductive characteristics of some weedy and ruderal Cruciferae species in Bulgaria. In: Third National Botanical Conference, Sofia, 26-30. 10(1981): 232–233.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Dobea, C. & B. Hahn. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 15–18.
CCDB · ipcn-api-dl — Yang, Y., Z. q. Lan & J. m. Yin. 1996. Karyotype study of the wild oil plant Descurainia sophia. Pp. 4--6 in P. Luo et al. (editors), Genet. Res. SouthW. China. Sichuan University Publishers, Chengdu.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Dvorak, F., F. Grull, K. Sutory & B. Dadakova. 1981. In Chromosome number reports LXXIII. Taxon 30:844.
CCDB · ipcn-api-dl — Maassoumi, A. A. R. 1980. Cruciferes de la flore d'lran. Etude Caryosystematique. Thesis, Strasbourg, 1980. 1–83.
CCDB · ipcn-api-dl — Murin, A. 1974. In Index of chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.
CCDB · ipcn-api-dl — Aryavand, A. 1977a. In IOPB chromosome number reports LVIII. Taxon 26: 557–565.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — PODLECH, D., & A. DIETERLE. 1969. Chromosomenstudien an afghanischen Pflanzen. Candollea 24: 185-243.
CCDB · book-ipcn75-78 — Murin 1974
CCDB · book-ipcn75-78 — Aryavand 1977a
CCDB · book-northern-plants — Baldwin & Campbell 1940, Jaretzky 1932.
CCDB · book-ipcn73-74 — GADELLA, T.W.J., & E. KLIPHUIS. 1973. Chromosome numbers of flowerinl plants in the Netherlands VI. Proc. Kon. Ned. Acad. Wet., ser. C 76: 303-311.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-indian_vol1 — Jaretzj{y, R. 1932; Baldwin, J.T. & Campbell, J.M. 1940 ; Love, A; & Love, D. 1956b; Mulligan, G.A. 1961a ; Taylor, R.L. & Mulligan, G.A. 1968; Podlech, D. & Dieterle, A. 1969
CCDB · book-indian_vol1 — Tischler, G. 1934; Rohweder, H. 1937
CCDB · eflora
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Rohweder 1937
CCDB · brass — Podlech & Dieterle
CCDB · brass — Dobes & Hahn
CCDB · brass — Parfenov & Dmitrieva
CCDB · brass — Ancev
CCDB · brass — Mulligan
CCDB · brass — Taylor & Mulligan
CCDB · brass — Yang et al.
CCDB · brass — Murn
CCDB · brass — Dvork et al.
CCDB · brass — Dvork & Dadkov
CCDB · brass — Lve & Lve
CCDB · brass — Aryavand
CCDB · brass — Gadella & Kliphuis
CCDB · brass — Pogan et al.
+22 more references
2n 1410×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +3
CCDB · iapt
CCDB · ipcn-api-dl — Krasnikov, A. A. & M. N. Lomonosova. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. I. Bot. Žhurn. (Moscow & Leningrad) 75: 116–118.
CCDB · ipcn-api-dl — BOCHANTSEVA, Z. P. 1972. O chislakh chromosom. Pp. 45-53 in Introd. Akkli. Rasteny Akad. Nauk Uzbekist. SSR.
CCDB · book-ipcn75-78 — Bochantseva 1972
CCDB · brass — Bochantzeva
CCDB · brass — Krasnikov & Lomonosova
CCDB · CromoCat 2015 — Kaur, D. & Singhal, V. K (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:894-895
CCDB · CromoCat 2015 — Krasnikov, A. A. & Lomonosova, M. N. (1990). Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region.I. Botani?eskij Žurnal (Moscow & Leningrad) 75: 116-118.
GIFT · GIFT (floras)
2n 205×CCDB · book-northern-plants · CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants +2
CCDB · book-northern-plants — Mayor 1934.
CCDB · book-indian_vol1 — Eaez-Major, A.B.1934 (Tischler, G.1938)
CCDB · book-atlas-flowering-plants — Baez-Major 1934
CCDB · CromoCat 2015 — Baez-Major, A.B. (1934). Estudio cariologico de algunas cruciferas y su interpretation en la sistematica Cavanillesia Altera 6:59-103
GIFT · GIFT (floras)
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Jeelani, R. M., Kumari, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1788-1789
2n 121×CCDB · brass
CCDB · brass — Saidabadi & Gorenflot
n 1421×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +2
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Lan, Y. z. & T. y. Cheo. 1989. Cytotaxonomical studies on Chinese species of Cruciferae. P. 283 in D. Hong (editor), Plant Chromosome Research 1987.
CCDB · ipcn-api-dl — Hill, L. M. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 19–20.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · ipcn-api-dl — Rodman, J. E. 1978. In IOPB chromosome number reports LXI. Taxon 27: 375–392.
CCDB · book-ipcn75-78 — Rodman 1978
CCDB · brass — Mulligan
CCDB · brass — Lan & Cheo
CCDB · brass — Arohonka
CCDB · brass — Tischler
CCDB · brass — Rohweder
CCDB · brass — Jaretzky
CCDB · brass — Khatoon & Ali
CCDB · brass — Rodman
CCDB · brass — Hill
CCDB · CromoCat 2015 — Hill, L. M. (1995b). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 19-20.
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Ghaffari, S. M. & Chariat-Panahi, M. S. (1985b). Chromosome counts of some Angiosperms from Iran. Iranian J. Bot. 3: 68-73.
CCDB · CromoCat 2015 — Rodman, J. E. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXI]. Taxon 27(4): 391.
n 105×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · brass +1
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · ipcn-api-dl — Dvorak, F., F. Grull, K. Sutory & B. Dadakova. 1981. In Chromosome number reports LXXIII. Taxon 30:844.
CCDB · brass — Maassoumi
CCDB · CromoCat 2015 — Dvorák, F., Grüll, F. Sutory, K. & Dadáková, B. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 844.
CCDB · CromoCat 2015 — Jeelani, R. M., Kumari, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1788-1789
n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kaur, D. & Singhal, V. K (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:894-895
CCDB · CromoCat 2015 — Baez-Major, A.B. (1934). Estudio cariologico de algunas cruciferas y su interpretation en la sistematica Cavanillesia Altera 6:59-103
n 71×CCDB · brass
CCDB · brass — Ghaffari & Chariat-Panahi
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness99.5% BUSCO
08Occurrence & distribution
Record type58 481 records
Wild obs. + sensor46 193
Museum / vouchered11 976
Cultivated / captive22
Other290
Origin
Native346
Introduced1 567
Range
Area of Occupancy AOO127 588 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy52% within 1 km
≤100 m 14 666≤1 km 6 023≤10 km 17 857>10 km 867
39 413 georeferenced · 6 780 without coordinates
Open the mapobservation + sensor46 193
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 812≤1 km 2 070≤10 km 2 965>10 km 1 067
6 914 georeferenced · 5 062 without coordinates
Open the institutions mapphysical evidence11 976
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 16
17 georeferenced · 5 without coordinates
Open the mapnot free-living22
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions216 of 386 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 373 |
| Helsinki, FI | 716 |
| Wuzhou, CN | 430 |
| Moscow State Universitylocation not on record | 420 |
| LDlocation not on record | 327 |
| Beijing, CN | 296 |
| BRNUlocation not on record | 242 |
| QAUlocation not on record | 241 |
| Olocation not on record | 231 |
| DAOlocation not on record | 222 |
| Uniwersytet Warszawskilocation not on record | 174 |
| Oulu, FI | 164 |
| Bronx, US | 143 |
| Claremont, US | 143 |
| MeiseBGlocation not on record | 142 |
| Berlin, DE | 141 |
| GMBAlocation not on record | 125 |
| Bern, CH | 117 |
| Trondheim, NO | 117 |
| Riverside, US | 116 |
| Flagstaff, US | 110 |
| Denver, US | 103 |
| ASUlocation not on record | 102 |
| Nanjing, CN | 102 |
| Xining, CN | 96 |
| Oskarshamn, SE | 95 |
| BFLlocation not on record | 94 |
| Turku, FI | 91 |
| Yangling, CN | 89 |
| SLU Artdatabankenlocation not on record | 88 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 87 |
| Chadron, US | 87 |
| Zürich, CH | 76 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 71 |
| Zürich, CH | 71 |
| University of Alberta Museumslocation not on record | 62 |
| Albuquerque, US | 60 |
| Chengdu, CN | 59 |
| Pullman, US | 59 |
| DOI/NPS, Greenbelt Parklocation not on record | 58 |
| Görlitz, DE | 57 |
| MAlocation not on record | 56 |
| Saint Louis, US | 53 |
| Phoenix, US | 52 |
| Moscow, US | 51 |
| Corvallis, US | 50 |
| KMNlocation not on record | 49 |
| South Kensington, GB | 48 |
| Bergen, NO | 48 |
| EL PASO, US | 47 |
| València, ES | 46 |
| Pocatello, US | 45 |
| Logan, US | 44 |
| Jyväskylä, FI | 43 |
| Santa Barbara, US | 42 |
| Salzburg, AT | 41 |
| TROMlocation not on record | 41 |
| CASlocation not on record | 41 |
| TUR-Alocation not on record | 40 |
| Kunming, CN | 40 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 38 |
| Tartu, EE | 38 |
| Boise, US | 38 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 37 |
| San Diego, US | 36 |
| Missoula, US | 35 |
| Lanzhou, CN | 34 |
| Chengdu, CN | 34 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 33 |
| Zhengzhou, CN | 32 |
| Chongqing Museumlocation not on record | 31 |
| Allentown, US | 31 |
| Barcelona, ES | 31 |
| Bozeman, US | 31 |
| Provincia di Livornolocation not on record | 31 |
| Fort Worth, US | 31 |
| Victoria, CA | 31 |
| Urumqi, CN | 30 |
| Madison, US | 28 |
| Davis, US | 28 |
| BIO-UNIPIlocation not on record | 28 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 27 |
| Wlocation not on record | 26 |
| Tallinn, EE | 26 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 25 |
| Guangzhou, CN | 25 |
| Garðabær, IS | 25 |
| NSMKlocation not on record | 25 |
| Xinxiang, CN | 24 |
| Canadian Department of Agriculturelocation not on record | 24 |
| Spearfish, US | 23 |
| St. Paul, US | 23 |
| Emporia, US | 23 |
| Henderson, US | 23 |
| UniKSlocation not on record | 22 |
| Provo, US | 22 |
| BClocation not on record | 20 |
| WNNUlocation not on record | 20 |
| Madrid, ES | 19 |
| Mlocation not on record | 19 |
| Caldwell, US | 18 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 18 |
| Kuopio, FI | 18 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 17 |
| Vancouver, CA | 17 |
| Ischia Marine Centrelocation not on record | 16 |
| Uniwersytet Jagiellońskilocation not on record | 16 |
| Natural History Museum Rotterdamlocation not on record | 16 |
| Lubbock, US | 15 |
| Uppsala, SE | 15 |
| GJOlocation not on record | 15 |
| Tampa, US | 15 |
| Austin, US | 14 |
| Nagano City, JP | 14 |
| Durango, US | 14 |
| Acadia Universitylocation not on record | 13 |
| Lausanne, CH | 13 |
| UGentlocation not on record | 13 |
| College of the Atlantic, Museumlocation not on record | 13 |
| National Institute of Biological Resourceslocation not on record | 12 |
| BDBClocation not on record | 12 |
| Eastern Nevada Landscape Coalitionlocation not on record | 12 |
| San Luis Obispo, US | 12 |
| Weber State Universitylocation not on record | 11 |
| Christchurch, NZ | 11 |
| Hermosillo, MX | 11 |
| Herbarium of South China Botanical Gardenlocation not on record | 11 |
| University of Stellenboschlocation not on record | 11 |
| Granada, ES | 11 |
| Salamanca, ES | 11 |
| Burlington, US | 11 |
| Tomioka, JP | 11 |
| San Isidro, AR | 11 |
| Urumqi, CN | 11 |
| Grand Junction, US | 11 |
| Seoul, KR | 11 |
| Beijing, CN | 10 |
| SZUlocation not on record | 10 |
| GZUlocation not on record | 10 |
| Odawara, JP | 10 |
| Brookings, US | 10 |
| Paris, FR | 10 |
| Pittsburg, US | 10 |
| Edinburgh, GB | 9 |
| Chapel Hill, US | 9 |
| Ashland, US | 9 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 9 |
| Castelar, AR | 9 |
| Nijmegen, NL | 9 |
| Ann Arbor, US | 9 |
| Karlsruhe, DE | 8 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 8 |
| Porvoo, FI | 8 |
| WINlocation not on record | 8 |
| Institute of the biological problems of the North FEB RASlocation not on record | 8 |
| Orem, US | 8 |
| Kushiro City Museumlocation not on record | 8 |
| Kew, GB | 7 |
| Lincoln, US | 7 |
| Shinshu Universitylocation not on record | 7 |
| New Haven, US | 7 |
| Entomological Society of Latvialocation not on record | 7 |
| Tacoma, US | 7 |
| University of New Hampshirelocation not on record | 7 |
| Tsukuba, JP | 7 |
| Tilburg, NL | 7 |
| Dresden, DE | 7 |
| Chengdu, CN | 6 |
| Jiangxi College of Educationlocation not on record | 6 |
| Dekalb, US | 6 |
| KIRMlocation not on record | 6 |
| IDElocation not on record | 6 |
| CJBGlocation not on record | 6 |
| Kyoto Universitylocation not on record | 6 |
| Phyletisches Museum Jenalocation not on record | 6 |
| SXTCMlocation not on record | 6 |
| Alicante, ES | 6 |
| Inner Mongolia Universitylocation not on record | 6 |
| Ciudad Autónoma de Buenos Aires, AR | 5 |
| Fredericton Stock Culture Collectionlocation not on record | 5 |
| Arcata, US | 5 |
| Wellington, NZ | 5 |
| Mexico City, MX | 5 |
| 5 | |
| Wuhan, CN | 5 |
| Awka, NG | 5 |
| Bourges, FR | 5 |
| Toronto, CA | 5 |
| Irvine, US | 5 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 5 |
| Millersville, US | 5 |
| Frankfurt am Main | 5 |
| Anchorage, US | 5 |
| BSBIlocation not on record | 5 |
| IWEP FEB RASlocation not on record | 5 |
| Bend, US | 5 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 5 |
| Rovaniemi, FI | 5 |
| Bangkok, TH | 5 |
| Cheney, US | 5 |
| Sion, CH | 5 |
| Portland, US | 5 |
| Forssa, FI | 4 |
| Shanghai, CN | 4 |
| Chicago, US | 4 |
| nbflocation not on record | 4 |
| Auckland, NZ | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| BAYLUlocation not on record | 4 |
| PRClocation not on record | 4 |
| Northridge, US | 4 |
| DBF-NHMDlocation not on record | 4 |
| Siouxland Heritage Museumlocation not on record | 4 |
| San Francisco, US | 4 |
| Brussel, BE | 4 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 4 |
| Santa Cruz, US | 4 |
| Tromso University Museumlocation not on record | 4 |
| Chiba, JP | 4 |
| Northeastern Forestry Universitylocation not on record | 4 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 4 |
| Taipei, TW | 4 |
| Minot State Universitylocation not on record | 3 |
| Bloomington, US | 3 |
| Frauenfeld, CH | 3 |
| KR | 3 |
| Pretoria, ZA | 3 |
| Canberra, AU | 3 |
| ENTClocation not on record | 3 |
| Wuhan, CN | 3 |
| US | 3 |
| Sant Julià de Lòria, AD | 3 |
| USFSlocation not on record | 3 |
| Green Bay, US | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| BGBMlocation not on record | 3 |
| EEZA-CSIClocation not on record | 3 |
| San Jose, US | 3 |
| Museo universitario di Chietilocation not on record | 3 |
| VALElocation not on record | 3 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 3 |
| UChlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Shanxi Universitylocation not on record | 3 |
| Fullerton, US | 3 |
| PrivatHerblocation not on record | 3 |
| Tempe, US | 3 |
| The University of Arizonalocation not on record | 3 |
| Los Angeles, US | 3 |
| Tokushima, JP | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| Changsha, CN | 3 |
| SIHUlocation not on record | 2 |
| Philadelphia, US | 2 |
| San Sebastián, ES | 2 |
| Long Beach, US | 2 |
| New Mexico Museum of Natural History and Sciencelocation not on record | 2 |
| H-Schuhwlocation not on record | 2 |
| Whitehorse, CA | 2 |
| ESP003location not on record | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Vitoria, ES | 2 |
| Otaru, JP | 2 |
| NMWlocation not on record | 2 |
| INFlocation not on record | 2 |
| Porrentruy, CH | 2 |
| Bratislava, SK | 2 |
| Cslocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Cambridge, US | 2 |
| Cambridge, US | 2 |
| Walla Walla, US | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| Sevilla, ES | 2 |
| Shanxi Institute of Biologylocation not on record | 2 |
| Hobart, AU | 2 |
| Turlock, US | 2 |
| KIWElocation not on record | 2 |
| Kandalaksha State Nature Reservelocation not on record | 2 |
| University of Lethbridgelocation not on record | 2 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 2 |
| CJBNlocation not on record | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| Philadelphia, US | 2 |
| GB | 2 |
| UoB-IBlocation not on record | 2 |
| Peking Universitylocation not on record | 2 |
| Fairfax, US | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Bureau of Land Managementlocation not on record | 1 |
| Staten Island, US | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Glocation not on record | 1 |
| Fargo, US | 1 |
| Toyama, JP | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Sagamihara, JP | 1 |
| Stephenville, US | 1 |
| Keene State Universitylocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Xian, CN | 1 |
| AUAlocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
| ISAlocation not on record | 1 |
| Chinese Academy of Forestrylocation not on record | 1 |
| Bando, JP | 1 |
| Hanshan Normal Universitylocation not on record | 1 |
| HUFDlocation not on record | 1 |
| Denton, US | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Gijón, ES | 1 |
| Saint John, CA | 1 |
| Fukushima Universitylocation not on record | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| Durham, US | 1 |
| Xiamen, CN | 1 |
| Clemson, US | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| OLAlocation not on record | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Dover, US | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| Badajoz, ES | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Yukon Universitylocation not on record | 1 |
| Columbia, US | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| Guangzhou, CN | 1 |
| Kathmandu, NP | 1 |
| Taipei, TW | 1 |
| Guilin, CN | 1 |
| Leiden University Medical Centerlocation not on record | 1 |
| JP | 1 |
| JBCLMlocation not on record | 1 |
| Dhaka, BD | 1 |
| Montréal, CA | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Williamsburg, US | 1 |
| Pamplona, ES | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| San Bernardino, US | 1 |
| Waverly, US | 1 |
| Davenport, US | 1 |
| Podgorica, ME | 1 |
| Montréal, CA | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
| Adelaide, AU | 1 |
| NBSIlocation not on record | 1 |
| No collectionlocation not on record | 1 |
| Madrid, ES | 1 |
| Umeå Universitylocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| Truckee, US | 1 |
| DNSMlocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Córdoba, AR | 1 |
| Austin, US | 1 |
| Omachi Alpine Museumlocation not on record | 1 |
| Mount Annan, AU | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Herb. BBGlocation not on record | 1 |
| Macomb, US | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Tuscaloosa, US | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Stockholm, SE | 1 |
| KURAlocation not on record | 1 |
| FLADlocation not on record | 1 |
| USFS/BHSClocation not on record | 1 |
| Fulda, DE | 1 |
| Mount Pleasant, US | 1 |
| Göteborg, SE | 1 |
| Corrientes, AR | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Fribourg, CH | 1 |
| Uberlândia, BR | 1 |
| Chinese Academy of Sciences, Xinjiang Institute of Ecology and Geography, Herbariumlocation not on record | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Hangzhou, CN | 1 |
386 institutions · 10 870 of 11 976 vouchered records shown · 1 003 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA47 detections
Where the DNA of Descurainia sophia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found47
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 47 detections have coordinates
Open the map7 countries0
in grass cutting waste groundIn crack in the pavement.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.0 °C 8.70–20.3
Seasonal swing summer↔winter26.0 °C
Max temp (day)19.2 °C 13.7–26.2
Min temp (night)11.1 °C 3.10–15.2
Precipitation65.1 mm/mo 12.4–103
Air humidity56.8 % 40.2–63.5
Moisture balance-66.1 mm/mo -159–47.2
Vapour deficit711 Pa 460–1,402
Wind speed3.40 m/s 1.90–5.60
Cloud cover38.2 % 29.8–58.2
CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.