Descurainia paradisa

(A.Nelson & P.B.Kenn.) O.E.Schulz · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Descurainia

At a glance

Occurrence records104

Data sources6

Biological traits10

DNA specimens0

eDNA detections5

Sources6 archives

Databases and archives Descurainia paradisa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility104 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF104 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingNCBIsequences

01Narrative

Descurainia paradisa is a plant species native to eastern and northern California, southeastern Oregon, Box Elder County in northwestern Utah, and most of Nevada. It grows in shrub communities at elevations of 1000 -.Flora of North America v 7 p 526BONAP (Biota of North America Project), floristic synthesis, Descurainia paradisa Descurainia paradisa is an annual herb up to 35 cm tall. Stems are often purple, branching at the base and sometimes above ground. Leaves are up to 3 cm long, pinnately lobed. Flowers are pale yellow, borne in a raceme. Fruits are egg-shaped, up to 5 mm long.Schulz, Otto Eugen. in Engler, Heinrich Gustav Adolf. 1924. Das Pflanzenreich IV. 105(Heft 86): 331Nelson, Aven & Kennedy, Patrick Beveridge. 1906. New Plants from the Great Basin. Proceedings of the Biological Society of Washington 19(31): 155-157.photo of isotype of Descurainia paradisa at Missouri Botanical GardenHickman, J. C. 1993. The Jepson Manual: Higher Plants of California 1–1400. University of California Press, Berkeley.Holmgren, N. H., P. K. Holmgren & A.J. Cronquist. 2005. Vascular plants of the intermountain west, U.S.A., subclass Dilleniidae. 2(B): 1–488. In A.J. Cronquist, A. H. Holmgren, N. H. Holmgren, J. L. Reveal & P. K. Holmgren (eds.) Intermountain Flora. Hafner Pub. Co., New York.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Descurainia paradisa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences5

eDNA detections5

The DNA barcodea real sequence read deposited for this species

ITSHQ896569.1 ↗611 bp

ACGT

TCGATACCTGTTCAAAACAGAACGACCCGTGAACATACGATCATCACTTGCGGCGGGCCGGTTTCTTAGCTGATCCCGTGCTTGCCGAAT …

Descurainia paradisa subsp. nevadensis isolate C8 clone 1 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

08Occurrence & distribution

Record type104 records

Wild obs. + sensor5

Museum / vouchered99

Origin

Native4

Range

Area of Occupancy AOO312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 2

5 georeferenced

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 6≤1 km 22≤10 km 18>10 km 5

51 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence99

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Corvallis, US	25
WTUlocation not on record	7
Caldwell, US	7
Claremont, US	7
Pullman, US	6
Logan, US	6
San Diego, US	4
Pocatello, US	3
CASlocation not on record	3
Moscow, US	3
Henderson, US	3
Flagstaff, US	3
Bronx, US	2
Phoenix, US	2
Provo, US	2
Bloomington, US	2
Mexico City, MX	1
Arcata, US	1
Riverside, US	1
US	1
Saint Louis, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Los Angeles, US	1
INFlocation not on record	1

25 institutions · 94 of 99 vouchered records shown · 5 without an institution code

09Environmental DNA5 detections

Where the DNA of Descurainia paradisa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)