Descurainia bourgaeana

(E.Fourn.) Webb · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Brassicales/Brassicaceae/Descurainia

At a glance

Occurrence records202

Data sources8

Biological traits22

DNA specimens0

eDNA detections4

Sources8 archives

Databases and archives Descurainia bourgaeana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility202 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF202 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 14

01Narrative

Descurainia bourgaeana est une espèce de plantes à fleurs appartenant à la famille des Brassicacées. Elle est endémique des îles Canaries et plus précisément des zones d'altitude de La Palma et Tenerife. Elle y forme des buissons atteignant jusqu'à un mètre dont les fleurs ont une couleur jaune intense.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Leaf length max20 mm

Plant height0.4 m

Plant height max1 m

Plant height min0.5 m

Seed mass0.14 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dehiscencedehiscent

Flower colouryellow

Flower length max4 mm

Flowering endJun

Flowering startApr

Life formshrub

Life spanperennial

Lifespan years6 years

Habitat & environment7

Climatesubtropical

Elevation max2 200 m

Elevation min1 800 m

Fruit typelegume

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: herb

Leaf formpartite

Woodinessnon-woody

⚠ sources differ — TRY: non-woody · GIFT: woody

Other traits1

Seeds per fruit11-100

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Descurainia bourgaeana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSDQ418709.1 ↗610 bp

ACGT

TCGATACCTGTCCAAAACAGAACGACCCGTGAACAAACGATCATCACTTGCGGTGGGCCGGTTTCTTACTGATCCCGTGCTTGCCGAATC …

Descurainia bourgeauana isolate B14 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Descurainia bourgaeana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 147×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-fedorov +2

CCDB · ipcn-api-dl — Suda, J., T. Kyncl & R. Freiová. 2003. Nuclear DNA amounts in Macaronesian angiosperms. Ann. Bot. (Oxford) 92: 153–164.

CCDB · book-ipcn67-71 — BORGEN, L. 1969. Chromosome numbers of vascular plants from the Canary Islands, with special reference to the occurence of polyploidy. Nytt Magasin for Botanik 16: 18-121.

CCDB · book-fedorov — Larsen 1960b

CCDB · book-fedorov — Larsen 1958b

CCDB · brass — Borgen

CCDB · brass — Bramwell

CCDB · kew — Lysák MA, Koch MA, Beaulieu JM, Meister A, Leitch IJ. 2009. The dynamic ups and downs of genome size evolution in Brassicaceae. Molecular Biology and Evolution 26: 85-98.

n 75×CCDB · brass · CCDB · Cave1958

CCDB · brass — Larsen

CCDB · brass — Borgen

CCDB · brass — Bramwell

CCDB · Cave1958 — Larsen 1958b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type202 records

Wild obs. + sensor195

Museum / vouchered7

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 102≤1 km 24≤10 km 6>10 km 8

140 georeferenced · 55 without coordinates

Open the mapobservation + sensor195

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
València, ES	2
MAlocation not on record	1
Saint Louis, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
LDlocation not on record	1

5 institutions · 6 of 7 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Descurainia bourgaeana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)