Deschampsia elongata
(Hook.) Munro · speciesAt a glance
Occurrence records2 501
Data sources11
Biological traits94
DNA specimens33
eDNA detections10
Sources11 archives
Databases and archives Deschampsia elongata's data was compiled from.
WikipediaWikimedia Foundation3 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility2 501 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics33 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources94 traits
Occurrence & distributionGBIF2 501 records
Environmental DNA1 datasets · 2 countries10 detections
DNA & barcodingBOLD · NCBI33 specimens
Genome at a glanceCCDB2n = 26
01Narrative
Deschampsia elongata is a species of grass known by the common name slender hairgrass.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology4
Plant height0.91 m
Seed mass0.254 mg
Seed mass max0.352 mg
Seed mass min0.142 mg
Life cycle & reproduction25
After harvest regrowth rateSlow
Bloom periodLate Spring
Coppice potentialNo
Flower colouryellow
Flower conspicuousNo
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryShort
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Resprout abilityNo
Seed spread rateModerate
Seedling vigorMedium
Vegetative spread rateModerate
Diet & foraging1
Parasiteindependent
Habitat & environment26
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max2 800 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Growth formherb
⚠ sources differ — GIFT: herb · TRY: Graminoid
Growth form USDABunch
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassYes
Root depth min8 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry19
Anaerobic toleranceMedium
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementLow
Fire resistantNo
Fire toleranceHigh
Frost free days min90 days
Moisture useLow
Nitrogen fixation levelNone
Precipitation max24 in
Precipitation min10 in
Protein potentialLow
Salinity toleranceMedium
Shade toleranceHigh
Soil pH max7.8 pH
Soil pH min6 pH
Temperature min-38 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound1 860 000 per lb
ToxicityNone
Veneer productNo
Other traits4
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
05DNA & barcoding33 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Deschampsia elongata has left across the world's sequence archives.
At a glance
DNA specimens33
Marker genes10
GenBank sequences10
eDNA detections10
Countries2
The DNA barcodea real sequence read deposited for this species
GCACGCGTCATCCAACCTGCCGGCGGGGCACCGTCCGTGCTCGGCCAAGTCCTCGCAACCTCCTCTTCTGGAGTGGGGGCTCGGGGTAAA …
Deschampsia elongata genomic DNA sequence contains ITS1, 5.8S rRNA gene, ITS2, specimen voucher Zulma Rugolo 1245 (B 10 0448863), same specimen was wrongy identified as Leptophyllochloa micrathera and used for sequence #LT159754 first published in Taxon 66: 42 (2017)
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL1★rbcLa★trnL-F★ITS5atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Deschampsia elongata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 26 n = 13
Ploidypolyploid inferred
Chromosome records26–262n range26median26mode2records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 262×CCDB · book-ipcn67-71 · CCDB · book-atlas-flowering-plants
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-atlas-flowering-plants — Fo
n 131×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.025 ↗
08Occurrence & distribution
Record type2 501 records
Wild obs. + sensor89
Museum / vouchered2 411
Other1
Origin
Native160
Range
Area of Occupancy AOO7 084 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy95% within 1 km
≤100 m 46≤1 km 12≤10 km 1>10 km 2
61 georeferenced · 28 without coordinates
Open the mapobservation + sensor89
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy59% within 1 km
≤100 m 162≤1 km 602≤10 km 497>10 km 37
1 298 georeferenced · 1 113 without coordinates
Open the institutions mapphysical evidence2 411
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions74 of 113 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Claremont, US | 186 |
| Davis, US | 180 |
| WTUlocation not on record | 156 |
| Arcata, US | 134 |
| Pullman, US | 119 |
| Corvallis, US | 111 |
| Moscow, US | 93 |
| Riverside, US | 91 |
| Angwin, US | 85 |
| Vancouver, CA | 84 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 80 |
| Missoula, US | 72 |
| Bronx, US | 58 |
| San Luis Obispo, US | 40 |
| Boise, US | 40 |
| Victoria, CA | 40 |
| Santa Barbara, US | 37 |
| Logan, US | 36 |
| Caldwell, US | 31 |
| San Isidro, AR | 30 |
| San Diego, US | 28 |
| CASlocation not on record | 28 |
| University of Stellenboschlocation not on record | 24 |
| Pocatello, US | 23 |
| Durango, MX | 22 |
| Bozeman, US | 20 |
| Provo, US | 20 |
| Ashland, US | 19 |
| Canadian Department of Agriculturelocation not on record | 19 |
| University of Alberta Museumslocation not on record | 14 |
| Ciudad Autónoma de Buenos Aires, AR | 13 |
| ASUlocation not on record | 13 |
| Flagstaff, US | 12 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 11 |
| Saint Louis, US | 10 |
| Tacoma, US | 10 |
| Fredericton Stock Culture Collectionlocation not on record | 9 |
| Portland, US | 8 |
| Bend, US | 8 |
| STNFlocation not on record | 8 |
| San Jose, US | 8 |
| US | 7 |
| Bloomington, US | 7 |
| Mexico City, MX | 6 |
| Los Angeles, US | 5 |
| Castelar, AR | 5 |
| Truckee, US | 5 |
| Weber State Universitylocation not on record | 5 |
| Ann Arbor, US | 5 |
| Henderson, US | 5 |
| St. Paul, US | 5 |
| SEFlocation not on record | 5 |
| EL PASO, US | 4 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 4 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 4 |
| VALElocation not on record | 4 |
| Orem, US | 4 |
| Phoenix, US | 4 |
| Autlán de Navarro, MX | 4 |
| Bureau of Land Management, Medford District Officelocation not on record | 3 |
| Pacific Lutheran Universitylocation not on record | 3 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 3 |
| Corrientes, AR | 3 |
| Tampa, US | 3 |
| Wuzhou, CN | 3 |
| Chongqing Museumlocation not on record | 3 |
| Ivano-Frankivsk, UA | 3 |
| Ensenada, MX | 3 |
| Eastern Nevada Landscape Coalitionlocation not on record | 3 |
| Austin, US | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| Cheney, US | 3 |
| Moscow State Universitylocation not on record | 3 |
| Oskarshamn, SE | 3 |
| Anchorage, US | 2 |
| Pittsburg, US | 2 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 2 |
| Dresden, DE | 2 |
| Plocation not on record | 2 |
| Nantes Culture Collectionlocation not on record | 2 |
| MeiseBGlocation not on record | 2 |
| Córdoba, AR | 2 |
| Davenport, US | 2 |
| Santa Cruz, US | 2 |
| Bangkok, TH | 2 |
| Bothell, US | 1 |
| Fayetteville, US | 1 |
| Clemson, US | 1 |
| Albuquerque, US | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Northridge, US | 1 |
| KNFHClocation not on record | 1 |
| Kew, GB | 1 |
| Philadelphia, US | 1 |
| Columbia, US | 1 |
| Mexico City, MX | 1 |
| New Mexico State Universitylocation not on record | 1 |
| Wlocation not on record | 1 |
| Zapopan, MX | 1 |
| Acadia Universitylocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| Chapingo, MX | 1 |
| GB | 1 |
| Royal British Columbia Museumlocation not on record | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Denver, US | 1 |
| Whitehorse, CA | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Lubbock, US | 1 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 1 |
113 institutions · 2 213 of 2 411 vouchered records shown · 196 without an institution code
09Environmental DNA10 detections
Where the DNA of Deschampsia elongata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map2 countries0
Slightly undulating, sloping area with dry u…Pine-Oak woodland, Soil: Boomer stony loam
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.6 °C 12.0–21.8
Seasonal swing summer↔winter19.2 °C
Max temp (day)21.2 °C 15.1–30.1
Min temp (night)10.7 °C 6.60–14.3
Precipitation56.1 mm/mo 7.50–89.9
Air humidity57.2 % 39.6–64.4
Moisture balance-69.3 mm/mo
Vapour deficit782 Pa 520–1,585
Wind speed2.20 m/s
Cloud cover38.7 % 20.9–49.7
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.