Deschampsia danthonioides

(Trin.) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Deschampsia

At a glance

Occurrence records548

Data sources11

Biological traits92

DNA specimens15

eDNA detections4

Sources11 archives

Databases and archives Deschampsia danthonioides's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility548 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources92 traits

Occurrence & distributionGBIF548 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI15 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Deschampsia danthonioides is a species of grass known by the common name annual hairgrass. It is native to western North America from the Yukon Territory and British Columbia, through California and the Western United States, to Baja California, and also to southern South America in Chile and Argentina. The annual bunchgrass grows in moist to drying areas such as pond edges, meadows and grasslands, in various habitat types such as montane and chaparral.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height0.46 m

Seed mass0.361 mg

⚠ sources differ — TRY: 0.361 mg · GIFT: 0.398 mg

Seed mass max0.57 mg

Seed mass min0.12 mg

Life cycle & reproduction24

After harvest regrowth rateSlow

Bloom periodMid Spring

Coppice potentialNo

Flower colouryellow

Flower conspicuousNo

Fruit seed period beginSpring

Fruit seed period endSummer

Growth rate USDAModerate

Life formannual

Life spanannual

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Raunkiær life formtherophyte

Resprout abilityNo

Seed spread rateModerate

Seedling vigorHigh

Vegetative spread rateNone

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerPorous

Foliage porosity winterPorous

Foliage textureFine

Fruit colourbrown

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid

Growth form USDABunch

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min6 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry20

Anaerobic toleranceLow

C:N ratioMedium

Caco3 toleranceMedium

Cold stratification requiredNo

Drought toleranceMedium

Fertility requirementLow

Fire resistantNo

Fire toleranceHigh

Frost free days min145 days

Moisture useMedium

Nitrogen fixation levelNone

Photosynthetic pathwayC3

Precipitation max30 in

Precipitation min12 in

Protein potentialLow

Salinity toleranceNone

Shade toleranceMedium

Soil pH max7.2 pH

Soil pH min5.8 pH

Temperature min52 °F

Uses & economy15

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityRoutinely Available

Fodder productYes

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalLow

Palatable graze animalLow

Palatable humanNo

Post productNo

Pulpwood productNo

Seeds per pound1 000 000 per lb

ToxicityNone

Veneer productNo

Other traits4

Fall conspicuousNo

Fruit seed abundanceHigh

Fruit seed conspicuousNo

Fruit seed persistenceNo

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Deschampsia danthonioides has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes11

GenBank sequences9

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSLR606558.1 ↗561 bpUSA

ACGT

GACCGGCACGCGTCATCCAACTGCCGGCGGCGGCACCGTCCGTGCTGGCCAAGTCCTCGACAACCTCCTCTTCTGGAGGGGGGCTCGGGG …

Deschampsia danthonioides genomic DNA sequence contains ITS1, 5.8S rRNA gene, ITS2, specimen voucher R.J. Soreng 5965 (US)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★rbcLa★trnL-F★ITS3★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Deschampsia danthonioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Myers 1947

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.025 ↗

08Occurrence & distribution

Record type548 records

Wild obs. + sensor181

Museum / vouchered367

Range

Area of Occupancy AOO1 632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 122≤1 km 13≤10 km 4>10 km 5

144 georeferenced · 37 without coordinates

Open the mapobservation + sensor181

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤1 km 42≤10 km 27>10 km 6

75 georeferenced · 292 without coordinates

Open the institutions mapphysical evidence367

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Riverside, US	127
Bronx, US	47
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	36
Canadian Department of Agriculturelocation not on record	24
Angwin, US	21
Vancouver, CA	18
Wuzhou, CN	17
Claremont, US	14
Victoria, CA	14
Davis, US	13
Severin-McDaniel Insect Collectionlocation not on record	5
EL PASO, US	5
Austin, US	4
Tampa, US	3
Ann Arbor, US	3
Turku, FI	2
Kew, GB	2
Istituto Agrario Castelnuovolocation not on record	2
Herbario Universidad de Concepciónlocation not on record	2
Beijing, CN	1
Odawara, JP	1
Logan, US	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Canadian Museum of Nature, National Herbarium of Canadalocation not on record	1
Sanda, JP	1
Yellowstone National Park Herbariumlocation not on record	1
Santa Barbara, US	1

27 institutions · 367 of 367 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Deschampsia danthonioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

Growing in rock cracks, thin soil developmen…Holland sandy loam

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 10.6–17.5

Seasonal swing summer↔winter16.0 °C

Max temp (day)17.5 °C 16.8–25.3

Min temp (night)10.5 °C 4.50–10.6

Precipitation36.4 mm/mo 10.0–74.2

Air humidity53.3 % 40.8–58.3

Moisture balance-87.7 mm/mo -165–-59.5

Vapour deficit632 Pa 585–1,191

Wind speed2.70 m/s 2.20–2.80

Cloud cover34.5 % 22.1–37.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)