Deschampsia chapmanii

Petrie · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Deschampsia

At a glance

Occurrence records305

Data sources10

Biological traits31

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Deschampsia chapmanii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility305 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF305 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT5.4 Gbp

01Narrative

Deschampsia chapmanii is a plant species in the grass (Poaceae) family, native to New Zealand and Macquarie Island.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology12

Leaf length max450 mm

Leaf width1 mm

Leaf width max1 mm

Leaf width min1 mm

Plant height0.2 m

Plant height max0.55 m

Seed length0.9 mm

Seed length max0.9 mm

Seed length min0.9 mm

Seed width0.35 mm

Seed width max0.35 mm

Seed width min0.35 mm

Life cycle & reproduction7

Life formperennial

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Reproduction asexualpresent

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecaryopsis

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid · TRY: Herb

Habitat GIFTAlpine

Mycorrhiza type0.00000000284

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Deschampsia chapmanii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAM041226.1 ↗595 bpNew Zealand

ACGT

TCGTGACCCTGACCAAAATAGACCGAGCACGCGTAATCCAACCTGCCGGCGGCGGCATCGTCCGTTGCTCGGCCAAGTCCTCGACAACCT …

Deschampsia chapmanii 5.8S rRNA gene, ITS1 and ITS2, from New Zealand:Eyre Mts., George Burn

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Deschampsia chapmanii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size5 403 450 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Deschampsia chapmanii5.4 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidy2× diploid · measured

Chromosome records26–262n range26median26mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 264×GoaT · Kew Plant DNA C-values Database · CCDB · new-zealand · CCDB · ipcn-api-dl +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · new-zealand

CCDB · ipcn-api-dl — Murray, B. G., P. J. de Lange & A. R. Ferguson. 2005. Nuclear DNA variation, chromosome numbers and polyploidy in the endemic and indigenous grass flora of New Zealand. Ann. Bot. (Oxford) 96: 1293–1305.

CCDB · kew — Murray BG, De Lange PJ, Ferguson AR. 2005. Nuclear DNA variation, chromosome numbers and polyploidy in the endemic and indigenous grass flora of New Zealand. Annals of Botany 96: 1293-1305.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.025 ↗

08Occurrence & distribution

Record type305 records

Wild obs. + sensor73

Museum / vouchered232

Range

Area of Occupancy AOO588 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 13≤1 km 51≤10 km 3

67 georeferenced · 6 without coordinates

Open the mapobservation + sensor73

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 4≤1 km 52≤10 km 16>10 km 3

75 georeferenced · 157 without coordinates

Open the institutions mapphysical evidence232

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wellington, NZ	91
Christchurch, NZ	38
Hobart, AU	28
Auckland, NZ	27
Canberra, AU	19
Adelaide, AU	6
Museo Entomologico de Leonlocation not on record	4
Brisbane, AU	2
AASlocation not on record	2
Kew, GB	2
Honolulu, US	2
AADClocation not on record	2
Palmerston, AU	2
MAlocation not on record	1
Mount Annan, AU	1
MeiseBGlocation not on record	1
Durham, US	1
Armidale, AU	1
Wlocation not on record	1
Rotorua, NZ	1

20 institutions · 232 of 232 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Deschampsia chapmanii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)