Deschampsia cespitosa
(L.) P.Beauv. · speciesAt a glance
Occurrence records783 041
Data sources12
Biological traits143
DNA specimens277
eDNA detections225
Sources12 archives
Databases and archives Deschampsia cespitosa's data was compiled from.
WikipediaWikimedia Foundation12 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility783 041 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI225 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics277 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources143 traits
Occurrence & distributionGBIF783 041 records
Environmental DNA2 datasets · 15 countries225 detections
DNA & barcodingBOLD · NCBI277 specimens
Genome at a glanceCCDB · GoaT4.6 Gbp
01Narrative
Deschampsia cespitosa, commonly known as tufted hairgrass or tussock grass, is a perennial tufted plant in the grass family Poaceae.Jepson Manual. 1993 Distribution of this species is widespread including the eastern and western coasts of North America, parts of South America, Eurasia and Australia. The species is cultivated as an ornamental garden plant, and numerous cultivars are available. The cultivars 'Goldschleier' and 'Goldtau' have gained the Royal Horticultural Society's Award of Garden Merit. It is a larval host to the Juba skipper and the umber skipper.The Xerces Society (2016), Gardening for Butterflies: How You Can Attract and Protect Beautiful, Beneficial Insects, Timber Press.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology24
Leaf length270 mm
Leaf length max450 mm
Leaf mass1 025 mg
⚠ sources differ — AusTraits: 1 025 mg · LEDA: 15.1 mg
Leaf mass per area316 g/m2
Leaf size943 mm²
⚠ sources differ — TRY: 943 mm² · AusTraits: 3 699 mm² · LEDA: 176 mm² · GIFT: 737 mm²
Leaf width4 mm
Leaf width max4 mm
Leaf width min4 mm
Plant height0.516 m
⚠ sources differ — GIFT: 0.516 m · AusTraits: 1 m · LEDA: 0.27 m · USDA: 1.04 m · TRY: 0.124 m
Plant height generative0.561 m
Plant height max1.5 m
Plant height min0.03 m
Seed length2.3 mm
⚠ sources differ — TRY: 2.3 mm · AusTraits: 2.98 mm · GIFT: 1.6 mm
Seed length max1.6 mm
Seed length min1.6 mm
Seed mass0.274 mg
⚠ sources differ — TRY: 0.274 mg · AusTraits: 0.299 mg · LEDA: 0.196 mg · GIFT: 5.58 mg
Seed mass max0.35 mg
Seed mass min0.1 mg
Seed volume0.18 mm³
Seed volume max0.18 mm³
Seed volume min0.18 mm³
Seed width1.66 mm
⚠ sources differ — AusTraits: 1.66 mm · GIFT: 0.7 mm
Seed width max0.7 mm
Seed width min0.7 mm
Life cycle & reproduction37
After harvest regrowth rateModerate
Bloom periodLate Summer
Coppice potentialNo
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dispersal typeanimal
⚠ sources differ — AusTraits: epizoochory · LEDA: agochor · GIFT: anemochorous
Flower colouryellow
Flower conspicuousNo
Flowering endJul
Flowering startJun
Flowering timeyyynnnnnyyyy
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryLong
Pollination modeabiotic
Pollination syndromeabiotic
⚠ sources differ — AusTraits: abiotic · GIFT: wind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Resprouting capacitypartial_resprouting
Seed number924
Seed spread rateSlow
Seedling vigorMedium
Self fertilizationabsent
Sex typehermaphrodite+monoecious
⚠ sources differ — AusTraits: hermaphrodite monoecious · GIFT: bisexual
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment31
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max4 900 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: H
Growth form USDABunch
Habitat GIFTarctic, meadows, tundra
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Leaf shapelanceolate
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min14 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry29
Anaerobic toleranceHigh
C:N ratioMedium
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min100 days
Leaf C:N ratio27.89 g/g
Leaf c442 mg/g
Leaf dry-matter content (LDMC)304 mg/g
⚠ sources differ — TRY: 304 mg/g · LEDA: 349 mg/g
Leaf n17.0 mg/g
Leaf p1.23 mg/g
Moisture useLow
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max24 in
Precipitation min14 in
Protein potentialLow
Salinity toleranceLow
Seed longevity index0
Shade toleranceHigh
Soil pH max7.2 pH
Soil pH min4.8 pH
Specific leaf area (SLA)13.59 mm²/mg
⚠ sources differ — TRY: 13.59 mm²/mg · LEDA: 14.22 mm²/mg · GIFT: 20.2 mm²/mg
Temperature min-38 °F
Wood density443 mg/cm³
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound1 308 333 per lb
ToxicityNone
Veneer productNo
Other traits5
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
05DNA & barcoding277 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Deschampsia cespitosa has left across the world's sequence archives.
At a glance
DNA specimens277
Marker genes13
GenBank sequences10
eDNA detections225
Countries15
The DNA barcodea real sequence read deposited for this species
CAAACACGCTCCTACCCCCTCATCGGGGATCGGGATGCGGCATGTGGCCCCCCGTCACGCAAGCGATGGTGGGCCGAAGATGTGGCTGCC …
Deschampsia cespitosa isolate CL2021-2024 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL1★rbcLa★trnL-F★ITS9★ITS1★ITS2atpF-atpHcp-trnL-intronpsbK-psbIrpoBrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Deschampsia cespitosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size4 586 820 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Deschampsia cespitosa4.59 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 26 n = 13
Ploidy2× diploid · measured
Chromosome records14–562n range26median26mode150records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2689×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · iapt +15
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · iapt
CCDB · new-zealand
CCDB · brit-fl — Jones, K. (1969)
CCDB · brit-fl — Hedberg, O. Svensk Bot. Tidskr. 52: 37-46 (1958)
CCDB · brit-fl — Davy, A.J. J. Ecol. 68: 1075-1096 (1980)
CCDB · brit-fl — Rothera, S.L., Davy, A.J. New Phytol. 102: 449-467 (1986)
CCDB · poland — Pogan E., Rychlewski J. et al. 1980 a. Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov. Ser. Bot. 22, 129-153.
CCDB · poland — Frey L. 1982. Cytotaxonomical studies on the genus Deschampsia P.B. sensu lato in Poland. Fragm. Flor. Geobot. 28, 117-144.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.
CCDB · ipcn-api-dl — Petrovsky, V. V. & P. G. ZHUKOVA. 1981. Chromosome numbers and taxonomy of some plant species of Wrangel Island. Bot. Zhurn. 66 (3): 380–387.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Guzik, M. B. 1984. Khromosomnye chisla nekotorykh dikorastushchikh zlakov Predural'ja. Ekologija Opylenija Rastenij. Mezhvuzovskij Sbornik Nauchnykh Trudov. Perm. 82–86.
CCDB · ipcn-api-dl — García-Suárez, R., C. Alonso-Blanco, M. C. Fernandez-Carvajal, J. A. Fernandez-Prieto, A. Roca & R. Giraldez. 1997. Diversity and systematics of Deschampsia sensu lato (Poaceae) inferred from karyotypes, protein electrophoresis, total genomic DNA hybridization and chloroplast DNA analysis. Pl. Syst. Evol. 205: 99–110.
CCDB · ipcn-api-dl — Pogan, E. 1980. Further studies in chromosome numbers of Polish Angiosperms. Acta Biol. Cracov., Ser. Bot. 22: 129–153.
CCDB · ipcn-api-dl — Parkash, O. 1979. Cytological investigations in some grasses of northeastern India (Festucoids, Ischaemum Linn., Eulalia Kunth and Saccharum spontaneum Linn.). Ph.D. Thesis, Chandigarh. 1979.
CCDB · ipcn-api-dl — Ghukasyan. 2004. Extent of karyological study of Armenian grasses (Poaceae). Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 85–89.
CCDB · ipcn-api-dl — Albers, F. 1980. Comparative karyology of the grass subtribes Aristaveninae and Airinae (Poaceae-Avenae). Pl. Syst. Evol. 136: 137–167.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1980. A karyotaxonomic study of the grasses of the Altai Mts. Bot. Zhurn. 65 (4): 509–520.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981. In Chromosome number reports LXX. Taxon 30: 72.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.
CCDB · ipcn-api-dl — Probatova, N. S. 1984. New taxa of the Poaceae from the Far East of the USSR. Bot. Zhurn. SSSR 69(2): 251–259.
CCDB · ipcn-api-dl — Probatova. 2005. A progress in the study of the chromosome numbers of rare and endemic species of the flora of the Russian Far East. Pages 85--86 in Karyology, Karyosystematics and Molecular Phylogeny. St. Petersburg, Russia.
CCDB · ipcn-api-dl — Probatova. 2004. Chromosome numbers of selected vascular plant species from Sakhalin, Moneron and the Kurile Islands. Biodivers. Biogeogr. Kuril Islands Sakhalin 1: 15–23.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · ipcn-api-dl — Beuzenberg, E. J. & J. B. Hair. 1983. Contributions to a chromosome atlas of the New Zealand flora - 25 miscellaneous species. New Zealand J. Bot. 21: 13–20.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1983. Chromosome numbers in flowering plants from Greece. Willdenowia 13: 329–333.
CCDB · book-ipcn66 — Taylor & Broclanan 1966
CCDB · book-ipcn72 — ALBERS, F. 1972. Cytotaxonamie und B-Chromosomen bei Deschampsia caespitosa CL.) P.B. und verwandten Arten. Beitr. Biol. Pflanzen 48: 1-62.
CCDB · book-ipcn67-71 — ALBERS, F. 1971. Cytotaxonomie and B-Chromosomen bei Deschampsia caespitosa (L.) P.B. und verwandten Arten. Beitr. Biol. Pflanzen 48: 1-62.
CCDB · book-ipcn67-71 — ZHUKOVA, P.G. 1969. Chromosome number in certain plant species indigenous to the north-east of the USSR. IV. Bot. Zurn. 54: 1985-1990.
CCDB · book-ipcn67-71 — KNABEN, G. 1968. Chromosome numbers of flowering plants from Central Alaska. Nytt mag. bot. 15: 240-254.
CCDB · book-ipcn67-71 — MULLIGAN, G.A., & A.E. PORSILD. 1969. Chromosome numbers of some plants from the unglaciated central Yukon plateau, Canada. Canad. J. Bot. 47: 655-662.
CCDB · book-ipcn67-71 — HEDBERG, o. 1967. Chromosome numbers of vascular plants from arctic and subarctic North America. Ark. f. Bot. Ser. 2. 6: 309-326.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
+43 more references
2n 5228×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · brit-fl +6
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · brit-fl — McAllister, H. (1972)
CCDB · brit-fl — Hedberg, O. Svensk Bot. Tidskr. 52: 37-46 (1958)
CCDB · brit-fl — McAllister, H. (1992)
CCDB · brit-fl — Rothera, S.L., Davy, A.J. New Phytol. 102: 449-467 (1986)
CCDB · fl-europaea — LOve & Lttve, 1956
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1980. Chromosome numbers and taxonomy of some species of the Anyui Mts. Bot. Zhurn. 65 (5): 651–659.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl — Petrovsky, V. V. & P. G. ZHUKOVA. 1981. Chromosome numbers and taxonomy of some plant species of Wrangel Island. Bot. Zhurn. 66 (3): 380–387.
CCDB · ipcn-api-dl — Albers, F. 1980. Comparative karyology of the grass subtribes Aristaveninae and Airinae (Poaceae-Avenae). Pl. Syst. Evol. 136: 137–167.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.
CCDB · ipcn-api-dl — Purdy, B. G. & R. J. Bayer. 1995. Genetic diversity in the tetraploid sand dune endemic Deschampsia mackenzieana and its widespread diploid progenitor D. cespitosa (Poaceae). Amer. J. Bot. 82(1): 121–130.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Chromosome numbers in some species of plants of the north-eastern part of the USSR. II. (In Russian). Bot. Zhur. 52: 983-987.
CCDB · book-ipcn67-71 — HEDBERG, o. 1967. Chromosome numbers of vascular plants from arctic and subarctic North America. Ark. f. Bot. Ser. 2. 6: 309-326.
CCDB · book-ipcn67-71 — SUDA, Y. 1969. In IOPB chromosome number reports xx. Taxon 18: 213-221:-
CCDB · book-indian_vol2 — Hedberg, O. 1967
CCDB · kew — Bennett MD, Smith JB, Lewis Smith RI. 1982. DNA amounts of angiosperms from the Antarctic and South Georgia. Environmental and Experimental Botany 22: 307-318.
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1976). Chromosome studies of the higher plants with euroasiatic distribution in Bulgaria. Fragm. Florist. Geobot. 22(3): 301-322.
CCDB · CromoCat 2015 — Stoeva, M. & S. Kozuharov. (1983). Kariologieno proucvane na tufestata plastica (Deschampsia caespitosa (L.) PB.) v Balgarija. In: Treta nacionalna konferencija po botanika : 223-231.
CCDB · CromoCat 2015 — Stoeva, M. P. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 579-580.
CCDB · CromoCat 2015 — Stoeva, M. P. (1988). Populacionna izmcncivost na Deschampsia caespitosa (L.) PB. v Balgarija. In: 100 ann. acad. N. Stojanov : 107-114.
CCDB · CromoCat 2015 — Kozuharov, S. J. & Petrova, A. V. (1973). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XL]. Taxon 22(2/3): 286-287.
CCDB · CromoCat 2015 — Rothera, S.L. & A.J. Davy. (1986). Polyploidy and habitat differentiation in Deschampsia cespitosa. New Phytologist 102: 449-467
2n 2410×CCDB · ipcn-api-dl · CCDB · Cave1963 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Davlianidze, M. & M. Mosulischvili. 1984. Numerus chromosomatum de plantis nonnullis Gramineae florae Georgiae. Not. Syst. Georg. Inst. Bot. Thbilissi. 40: 68–72.
CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.
CCDB · ipcn-api-dl — Gvinianidze, Z. I. & A. A. Avazneli. 1982. Khromosomnye chisla nekotorykh predstavitelej vysokogornykh floristicheskikh kompleksov Kavkaza. Soobkskc. Akad. Nauk Gruzinskoi SSR, Inst. Bot., Trudy, Ser. Geobot. 106 (3): 577–580.
CCDB · Cave1963 — Sokolovskaya 1963
CCDB · CromoCat 2015 — Kozuharov, S. & Kuzmanov, B. (1964b). Chromosome numbers of some Bulgarian plants species. Ann. Univ. Sof. Fac. Biol. Geol. Georg. 57(1): 103-107.
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1976). Chromosome studies of the higher plants with euroasiatic distribution in Bulgaria. Fragm. Florist. Geobot. 22(3): 301-322.
CCDB · CromoCat 2015 — Stoeva, M. & S. Kozuharov. (1983). Kariologieno proucvane na tufestata plastica (Deschampsia caespitosa (L.) PB.) v Balgarija. In: Treta nacionalna konferencija po botanika : 223-231.
CCDB · CromoCat 2015 — Davlianidze, M. & Mosulisivili, M. (1984). Numerus chromosomatum de plantis nonnullis Gramineae florae Georgiae. Zametki Sist. Georgr. Rast. 40: 68-72.
CCDB · CromoCat 2015 — Engelskjon, T. (1979). Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1-38.
CCDB · CromoCat 2015 — Gvinianidze, Z. & Avazneli, A. (1982). Khromosomnye chisla nekotorykh predstavitelej vysokogornykh floristicheskikh kompleksov Kavkaza. Soobkskc Akademiia Nauk Gruzinskoi SSR : Institut Botaniki : Trudy : Seriia Geobtanika 106 (3): 577-580.
2n 2810×CCDB · fl-europaea · CCDB · book-ipcn65 · CCDB · book-ipcn67-71 +3
CCDB · fl-europaea — Sokolovskaya &
CCDB · book-ipcn65 — Zhukova 1965a
CCDB · book-ipcn67-71 — LAANE, M. M. 1967. KromosomundersBkelser i Cst-Finnmarks flora. II. (Chromosome numbers in the flora of eastern Finmark. II.) ,Blyttia 25: 45-54.
CCDB · book-northern-plants — Hagerup 1939.
CCDB · book-indian_vol2 — Avdulov, N.P. (Fedorov) ; Tischler, G. 1934 ; Rohweder, H. 1937 ; Hagerup, O. 1939 ; Delay, C. 1947 ; Gustafsson, A. 1947b ; Quezel, P. 1957
CCDB · book-indian_vol2 — Laane, M.M. 1967
CCDB · book-atlas-flowering-plants — Fo
CCDB · book-atlas-flowering-plants — Tateoka "
CCDB · book-atlas-flowering-plants — Hagerup 1939
2n 495×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · Cave1963
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)
CCDB · brit-fl — Tutin, T.G. Opera Bot. 5: 363-373 (1961)
CCDB · Cave1963 — Kawano 1963
2n 563×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · book-northern-plants
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Tutin, T.G. Opera Bot. 5: 363-373 (1961)
CCDB · book-northern-plants — Hagerup 1939.
2n 182×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Davlianidze, M. T. 1985. Chromosome numbers in the representatives of the flora from Georgia. Bot. Zhurn. SSSR 70(5): 698–700. (In Russian).
CCDB · CromoCat 2015 — Davlianidze, M. (1985). Chromosome numbers in the representatives of the flora from Georgia. Bot. Žurn. 70: 698-700.
2n 322×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Wycherley, P.R. Watsonia 3: 41-56 (1953)
2n 392×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · book-atlas-flowering-plants
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · book-atlas-flowering-plants — Bocher & L. 1950
2n 141×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Hedberg, O. (1986). On the manifestation of vivipary in Deschampsia caespitosa s. lat. Symbolae Botanicae Upsaliensis 27: 183-192
2n 211×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Hedberg, O. (1986). On the manifestation of vivipary in Deschampsia caespitosa s. lat. Symbolae Botanicae Upsaliensis 27: 183-192
2n 271×CCDB · Cave1956supp
CCDB · Cave1956supp — Tateoka 1955
2n 341×GoaT · DTOL Flowering Plants Estimates Kew
GoaT · DTOL Flowering Plants Estimates Kew
2n 361×GoaT · DTOL Flowering Plants Estimates Kew
GoaT · DTOL Flowering Plants Estimates Kew
2n 371×GoaT · DTOL Flowering Plants Estimates Kew
GoaT · DTOL Flowering Plants Estimates Kew
2n 381×GoaT · DTOL Flowering Plants Estimates Kew
GoaT · DTOL Flowering Plants Estimates Kew
2n 441×GoaT · DTOL Flowering Plants Estimates Kew
GoaT · DTOL Flowering Plants Estimates Kew
2n 501×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.
n 1311×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Chinnappa, C. C. & J. G. Chmielewski. 1987. Documented plant chromosome numbers 1987: 1. Miscellaneous counts from western North America. Sida 12: 409–417.
CCDB · ipcn-api-dl — Parkash, O. 1979. Cytological investigations in some grasses of northeastern India (Festucoids, Ischaemum Linn., Eulalia Kunth and Saccharum spontaneum Linn.). Ph.D. Thesis, Chandigarh. 1979.
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · ipcn-api-dl — Mehra, P. N. 1982. Cytology of East Indian grasses. ý.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — VON WEIHE, K., & G. REESE. 1968. Deschampsia wibeliana (Sonder) Parlatore. Beitrage zur Monographie einer Art des Tidegebietes. Bot. Jahrb. 88: 1-48.
CCDB · CromoCat 2015 — Mehra, P. N. & O. P. Sood. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIV]. Taxon 25(5/6): 631-632.
CCDB · CromoCat 2015 — Chinnappa, C. C. & Chmielewski, J. G. (1987). Documented plant chromosome numbers 1987: 1. Miscellaneous from western north Americ Sida 12: 409-417.
CCDB · CromoCat 2015 — Mehra, P. N. (1982). Cytology of East Indian grasses
CCDB · CromoCat 2015 — Parkash, O. (1979). Cytological investigations in some grasses of northeastern India (Festucoids, Ischaemum Linn., Eulalia Kunth and Saccharum spontaneum Linn.). Ph.D. Thesis, Chandigarh. 1979.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Lubogoschinsky, P. I. & Fleckenstein, K. M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:889-891
n 181×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Dalgaard, V. 1989. Additional chromosome numbers in vascular plants from the Disko Bugt area (west Greenland). Willdenowia 19: 199–213.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.025 ↗
07Deep time~2.65 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin2.65 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type783 041 records
Wild obs. + sensor745 295
Museum / vouchered29 950
Cultivated / captive871
Other6 925
Origin
Native40 863
Introduced11
Range
Area of Occupancy AOO684 964 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy61% within 1 km
≤100 m 191 335≤1 km 193 114≤10 km 244 345>10 km 2 840
631 634 georeferenced · 113 661 without coordinates
Open the mapobservation + sensor745 295
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy39% within 1 km
≤100 m 1 946≤1 km 7 323≤10 km 13 366>10 km 1 358
23 993 georeferenced · 5 957 without coordinates
Open the institutions mapphysical evidence29 950
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy25% within 1 km
≤100 m 8≤1 km 12≤10 km 41>10 km 19
80 georeferenced · 791 without coordinates
Open the mapnot free-living871
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions147 of 294 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 16 785 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 166 |
| Helsinki, FI | 837 |
| Moscow State Universitylocation not on record | 813 |
| Salzburg, AT | 662 |
| LDlocation not on record | 612 |
| BFLlocation not on record | 531 |
| Olocation not on record | 379 |
| Bronx, US | 256 |
| Victoria, CA | 248 |
| Oulu, FI | 195 |
| MeiseBGlocation not on record | 188 |
| Trondheim, NO | 185 |
| University of Stellenboschlocation not on record | 178 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 169 |
| Bergen, NO | 168 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 163 |
| University of Alberta Museumslocation not on record | 161 |
| Irkutsk State Universitylocation not on record | 157 |
| Tartu, EE | 144 |
| Corvallis, US | 140 |
| TROMlocation not on record | 137 |
| Oskarshamn, SE | 134 |
| Davis, US | 122 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 122 |
| Hobart, AU | 116 |
| Québec, CA | 112 |
| Missoula, US | 109 |
| Turku, FI | 104 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 101 |
| Université Lavallocation not on record | 100 |
| Logan, US | 98 |
| Uppsala, SE | 98 |
| Museo Entomologico de Leonlocation not on record | 97 |
| SLU Artdatabankenlocation not on record | 91 |
| Moscow, US | 84 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 83 |
| Saint Louis, US | 78 |
| Görlitz, DE | 78 |
| Provincia di Livornolocation not on record | 77 |
| Christchurch, NZ | 74 |
| Arcata, US | 73 |
| BRNUlocation not on record | 72 |
| Jyväskylä, FI | 71 |
| Berlin, DE | 70 |
| Kuopio, FI | 67 |
| WTUlocation not on record | 67 |
| KMNlocation not on record | 64 |
| Denver, US | 60 |
| Auckland, NZ | 57 |
| Chongqing Museumlocation not on record | 57 |
| Ann Arbor, US | 55 |
| DBF-NHMDlocation not on record | 55 |
| Wlocation not on record | 54 |
| Bern, CH | 54 |
| Wellington, NZ | 54 |
| Tallinn, EE | 52 |
| POL003location not on record | 50 |
| Wuzhou, CN | 49 |
| Dresden, DE | 46 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 44 |
| South Kensington, GB | 43 |
| Barcelona, ES | 42 |
| GJOlocation not on record | 41 |
| Canberra, AU | 41 |
| Boise, US | 41 |
| BDBClocation not on record | 41 |
| Pocatello, US | 38 |
| València, ES | 37 |
| Kew, GB | 37 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 36 |
| Rocky Mountain Biological Laboratorylocation not on record | 35 |
| Uniwersytet Jagiellońskilocation not on record | 35 |
| Kandalaksha State Nature Reservelocation not on record | 35 |
| BClocation not on record | 32 |
| Anchorage, US | 32 |
| Bloomington, US | 30 |
| Karlsruhe, DE | 29 |
| Mount Annan, AU | 27 |
| Albuquerque, US | 27 |
| Madison, US | 26 |
| Riverside, US | 25 |
| GMBAlocation not on record | 24 |
| Yangling, CN | 24 |
| Claremont, US | 23 |
| Adelaide, AU | 22 |
| Fredericton Stock Culture Collectionlocation not on record | 22 |
| San Luis Obispo, US | 21 |
| Canadian Museum of Naturelocation not on record | 21 |
| Lausanne, CH | 20 |
| Frankfurt am Main | 20 |
| St. Paul, US | 19 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 19 |
| Philadelphia, US | 19 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 18 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 18 |
| Burlington, US | 18 |
| WINlocation not on record | 18 |
| Tampa, US | 17 |
| Glarus, CH | 17 |
| MAlocation not on record | 16 |
| Provo, US | 16 |
| UGentlocation not on record | 15 |
| Porrentruy, CH | 15 |
| Brisbane, AU | 15 |
| CJBGlocation not on record | 15 |
| Mlocation not on record | 15 |
| Bozeman, US | 15 |
| Caldwell, US | 14 |
| Saint John, CA | 14 |
| Los Angeles, US | 13 |
| Pullman, US | 13 |
| Portland, US | 13 |
| GZUlocation not on record | 13 |
| Canadian Department of Agriculturelocation not on record | 13 |
| Entomological Society of Latvialocation not on record | 13 |
| Toronto, CA | 12 |
| Vitoria, ES | 11 |
| HUN003location not on record | 11 |
| Porvoo, FI | 11 |
| Natural History Museum Rotterdamlocation not on record | 9 |
| QVMAGlocation not on record | 9 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 9 |
| Millersville, US | 9 |
| ASUlocation not on record | 8 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 8 |
| TUR-Alocation not on record | 8 |
| PRClocation not on record | 8 |
| Dekalb, US | 8 |
| Pittsburg, US | 8 |
| Rovaniemi, FI | 7 |
| Bend, US | 7 |
| GBR016location not on record | 7 |
| Madrid, ES | 7 |
| Paris, FR | 6 |
| Ashland, US | 6 |
| SZUlocation not on record | 6 |
| Bangkok, TH | 6 |
| Santa Cruz, US | 6 |
| Flagstaff, US | 6 |
| Blumenau, BR | 6 |
| Yellowstone National Park Herbariumlocation not on record | 6 |
| Tromso University Museumlocation not on record | 6 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 6 |
| BSBIlocation not on record | 6 |
| LfUlocation not on record | 5 |
| Royal British Columbia Museumlocation not on record | 5 |
| Forssa, FI | 5 |
| San Diego, US | 5 |
| US | 5 |
| USFS/BHSClocation not on record | 5 |
| STNFlocation not on record | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 5 |
| CASlocation not on record | 5 |
| John May Museum of Natural Historylocation not on record | 5 |
| Green Bay, US | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| Rotorua, NZ | 5 |
| Sant Julià de Lòria, AD | 5 |
| Herb. BBGlocation not on record | 5 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 5 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 5 |
| AUAlocation not on record | 5 |
| University of Winnipeglocation not on record | 5 |
| Frauenfeld, CH | 4 |
| Spearfish, US | 4 |
| Chicago, US | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| Truckee, US | 4 |
| Metsähallituslocation not on record | 4 |
| UFSClocation not on record | 4 |
| San Jose, US | 4 |
| Tula State Universitylocation not on record | 4 |
| Armidale, AU | 4 |
| Universidade Federal de Santa Catarinalocation not on record | 4 |
| Trois-Rivières, CA | 4 |
| Tilburg, NL | 4 |
| Pamplona, ES | 4 |
| Northridge, US | 4 |
| Elocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| University of Manitoba Herbariumlocation not on record | 3 |
| Universität Göttingenlocation not on record | 3 |
| Bourges, FR | 3 |
| University of Alaska Museum of the Northlocation not on record | 3 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 3 |
| Stockholm, SE | 3 |
| Universidade Federale do Rio Grande do Sullocation not on record | 3 |
| Salamanca, ES | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| VALElocation not on record | 3 |
| Tempe, US | 3 |
| Taipei, TW | 3 |
| TAIElocation not on record | 3 |
| Namur, BE | 3 |
| Coimbra, PT | 2 |
| Monastir, TN | 2 |
| Fort Bragg, US | 2 |
| University of Hamburglocation not on record | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Taipei, TW | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| UChlocation not on record | 2 |
| ZRC-SAZUlocation not on record | 2 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 2 |
| Royal Alberta Museumlocation not on record | 2 |
| KR | 2 |
| KOMlocation not on record | 2 |
| NMBU:MINAlocation not on record | 2 |
| Alicante, ES | 2 |
| Irvine, US | 2 |
| Phoenix, US | 2 |
| Zürich, CH | 2 |
| Durango, US | 2 |
| OLAlocation not on record | 2 |
| US | 2 |
| Chadron, US | 2 |
| Xiamen, CN | 2 |
| nbflocation not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| University of Lethbridgelocation not on record | 2 |
| Palmerston, AU | 2 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Oswego, US | 1 |
| Brasília, BR | 1 |
| Weber State Universitylocation not on record | 1 |
| Dhaka, BD | 1 |
| Emporia, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| San Angelo, US | 1 |
| UFSMlocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| IWEP FEB RASlocation not on record | 1 |
| Columbia, US | 1 |
| Guasave, MX | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Siberian Federal Universitylocation not on record | 1 |
| Churchill Northern Studies Centrelocation not on record | 1 |
| State University of New York, College at Oneontalocation not on record | 1 |
| Sion, CH | 1 |
| Research Collection of Jonathan Farrlocation not on record | 1 |
| La Trobe Universitylocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Smithfield, AU | 1 |
| Fribourg, CH | 1 |
| Philadelphia, US | 1 |
| NTNU University Museum, Department of Natural Historylocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| New Haven, US | 1 |
| SEINetlocation not on record | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Montréal, CA | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| BIO-UNIPIlocation not on record | 1 |
| Durham, US | 1 |
| Plocation not on record | 1 |
| FLADlocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Chicago, US | 1 |
| Badajoz, ES | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Cheney, US | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Bothell, US | 1 |
| Vancouver, CA | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Fairfax, US | 1 |
| CICYTEXlocation not on record | 1 |
| Fargo, US | 1 |
| Nijmegen, NL | 1 |
| SVK001location not on record | 1 |
| Orem, US | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Umeå Universitylocation not on record | 1 |
| NoColllocation not on record | 1 |
| PTHlocation not on record | 1 |
| Clemson, US | 1 |
| Tuscaloosa, US | 1 |
| GB | 1 |
| DULlocation not on record | 1 |
| Acadia Universitylocation not on record | 1 |
| Mexico City, MX | 1 |
| no localizadalocation not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Mount Pleasant, US | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| University of Hulllocation not on record | 1 |
| Zürich, CH | 1 |
294 institutions · 29 193 of 29 950 vouchered records shown · 512 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA225 detections
Where the DNA of Deschampsia cespitosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found225
Studies independent surveys2
Countries15
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 225 detections have coordinates
Open the map15 countries0
prairie alpineexposed beachWetWetland swale in drainage between two rocky …Bare ground to grassy area on hilltopActive drifting sand dunes ca. 75 ft. tall; …
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median8.20 °C 2.10–14.4
Seasonal swing summer↔winter25.8 °C
Max temp (day)11.8 °C 2.50–19.5
Min temp (night)5.70 °C -1.40–11.5
Precipitation60.2 mm/mo 31.6–144
Air humidity62.8 % 55.2–69.4
Moisture balance-17.1 mm/mo -71.6–182
Vapour deficit410 Pa 245–739
Wind speed4.40 m/s 2.20–6.90
Cloud cover55.9 % 38.1–75.9
CHELSA 1981–2010, ~9 km grid, at location & month of 116 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.