Deschampsia antarctica

É.Desv. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Deschampsia

At a glance

Occurrence records1 192

Data sources12

Biological traits24

DNA specimens8

eDNA detections8

Sources12 archives

Databases and archives Deschampsia antarctica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 035 records↗

OBISOcean Biodiversity Information System157 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Chemical compositionLOTUS19 compounds

Occurrence & distributionGBIF · OBIS1 192 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB · GoaT4.9 Gbp

01Narrative

Deschampsia antarctica, la canche antarctique, est une espèce de plantes monocotylédones de la famille des Poaceae. C'est l'une des deux seules espèces de plantes vasculaires indigènes de l'Antarctique, l'autre étant Colobanthus quitensis de la famille des Caryophyllaceae. Cette petite graminée est présente sur les îles Orcades du Sud et les îles Shetland du Sud et le long de la côte occidentale de la péninsule Antarctique. On la retrouve en Argentine et au Chili.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology3

Seed mass0.29 mg

Seed mass max0.29 mg

Seed mass min0.29 mg

Life cycle & reproduction5

Deciduousnessn.d.

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max900 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecaryopsis

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid · TRY: Grasses&Sedges

Mycorrhiza type0.00000000284

Woodinessnon-woody

Physiology & chemistry4

Leaf n37.44 mg/g

Leaf p4.09 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)6.67 mm²/mg

03Chemical composition19 compounds

Compounds documented for Deschampsia antarctica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Unsaturated fatty acids7

Flavones7

Branched fatty acids $ Unsaturated fatty acids2

Cinnamic acids and derivatives2

Glycerophosphoglycerols1

Documented compounds19 total

Tissue Source Quantified only

Compound	Amount	Source
(Z)-2-Hexenoic acid	present	LOTUS
2,4-Octadienoic acid	present	LOTUS
2-(3,4-Dihydroxyphenyl)-8-beta-D-glucopyranosyl-5-hydroxy-7-methoxy-4H-1-benzopyran-4-one	present	LOTUS
7-O-Methylvitexin	present	LOTUS
8-[(2S,3R,4S,5S,6S)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2R,3R,4R,5S)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]-5-hydroxy-2-(4-hydroxyphenyl)-7-methoxychromen-4-one	present	LOTUS
butyl acetate	present	LOTUS
Hexenoic acid	present	LOTUS
Oct-2-enoic acid	present	LOTUS
Octa-2,4,6-trienic acid	present	LOTUS
Octa-2,4,6-trienoic acid	present	LOTUS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Deschampsia antarctica has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes2

GenBank sequences10

eDNA detections8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR908247.1 ↗340 bpUnited Kingdom

ACGT

ACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAATAG …

Deschampsia antarctica isolate 10-G-50(8) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS2

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Deschampsia antarctica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 890 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Deschampsia antarctica4.89 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidy2× diploid · measured

Chromosome records26–262n range26median26mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 262×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Bennett MD, Smith JB, Lewis Smith RI. 1982. DNA amounts of angiosperms from the Antarctic and South Georgia. Environmental and Experimental Botany 22: 307-318.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.025 ↗

08Occurrence & distribution

Record type1 192 records

Wild obs. + sensor200

Museum / vouchered980

Cultivated / captive2

Other10

Origin

Native25

Range

Area of Occupancy AOO1 860 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 85≤1 km 34≤10 km 18>10 km 14

151 georeferenced · 49 without coordinates

Open the mapobservation + sensor200

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 6≤1 km 82≤10 km 87>10 km 21

196 georeferenced · 784 without coordinates

Open the institutions mapphysical evidence980

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
AASlocation not on record	325
British Antarctic Surveylocation not on record	85
Paris, FR	57
Ciudad Autónoma de Buenos Aires, AR	45
Kew, GB	39
San Isidro, AR	29
Córdoba, AR	23
Hobart, AU	23
University of Stellenboschlocation not on record	19
Canberra, AU	7
Uniwersytet Warszawskilocation not on record	7
UnBlocation not on record	7
Turku, FI	6
AADClocation not on record	6
Wellington, NZ	6
Auckland, NZ	5
Saint Louis, US	5
BClocation not on record	4
Londrina, BR	4
Buenos Aires, AR	4
Adam Mickiewicz University in Poznańlocation not on record	3
Wlocation not on record	3
Museo Entomologico de Leonlocation not on record	2
Herbario Universidad de Concepciónlocation not on record	2
UFMSlocation not on record	2
Castelar, AR	2
Xiamen, CN	2
Universität Tübingenlocation not on record	2
Görlitz, DE	2
Olocation not on record	1
Claremont, US	1
Université de Bordeauxlocation not on record	1
Masindi, UG	1
Tartu, EE	1
Dresden, DE	1
Natural History Museum Rotterdamlocation not on record	1
Zürich, CH	1
Viña del Mar, CL	1
LDlocation not on record	1
Uppsala, SE	1
Museu Paraense Emílio Goeldilocation not on record	1
Mount Annan, AU	1

42 institutions · 739 of 980 vouchered records shown · 81 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Deschampsia antarctica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-3.10 °C -3.60–-2.60

Seasonal swing summer↔winter8.50 °C

Max temp (day)-1.70 °C -2.10–-1.20

Min temp (night)-4.50 °C -5.20–-4.10

Precipitation137 mm/mo 136–223

Air humidity63.1 % 62.1–68.2

Vapour deficit182 Pa 164–184

Cloud cover58.6 % 54.6–58.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Deschampsia antarctica

At a glance

Sources12 archives

Size & morphology3

Life cycle & reproduction5

Diet & foraging1

Habitat & environment11

Physiology & chemistry4

Compound class profile5 classes

Documented compounds19 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 192 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions24 of 42 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 192 records