Derris elliptica

(Wall.) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Derris

At a glance

Occurrence records199

Data sources11

Biological traits24

DNA specimens23

eDNA detections18

Sources11 archives

Databases and archives Derris elliptica's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility199 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Chemical compositionLOTUS · NPASS26 compounds

Occurrence & distributionGBIF199 records

Environmental DNA1 datasets · 3 countries18 detections

DNA & barcodingBOLD · NCBI23 specimens

Genome at a glanceGoaTgenome

01Narrative

Blüten Die Tubawurzel (Paraderris elliptica) ist eine Pflanzenart aus der Gattung (Paraderris) in der Unterfamilie der Schmetterlingsblütler (Faboideae) innerhalb der Familie der Hülsenfrüchtler (Fabaceae). Sie ist im südlichen Asien und Südostasien heimisch.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology4

Fruit length52.5 mm

Leaf length200 mm

Petiole length0.5 cm

Plant height16 m

Life cycle & reproduction6

Deciduousnessevergreen

Dispersal type detailedanemochorous

Life formclimbing shrub

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: climber_woody shrub · TRY: Climber

Leaf compoundnesscompound

Leaf shapenarrowly_oblong obovate

Succulenceno

Woodinessvariable

⚠ sources differ — TRY: variable · AusTraits: woody · GIFT: variable

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition26 compounds

Compounds documented for Derris elliptica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Rotenoids11

Isoflavanones $ Rotenoids6

Aminosugars $ Pyrrolidine alkaloids2

Plant xanthones1

Aminoacids1

Documented compounds26 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Deguelin;(-)-cis-Deguelin	present	LOTUS
(1)Benzopyrano(3,4-b)furo(2,3-h)(1)benzopyran-6(6aH)-one, 1,2,12,12a-tetrahydro-8,9-dimethoxy-2-(1-methylethenyl)-, (2S-(2alpha,6aalpha,12aalpha))-	present	NPASS
(1S,12S,13S)-16,17-dimethoxy-2,7,20-trioxapentacyclo[11.8.0.03,11.04,8.014,19]henicosa-3(11),4(8),5,9,14,16,18-heptaen-12-ol	present	LOTUS
(1S,13S)-10-hydroxy-16,17-dimethoxy-2,7,20-trioxapentacyclo[11.8.0.03,11.04,8.014,19]henicosa-3(11),4(8),5,9,14,16,18-heptaen-12-one	present	LOTUS
(Z)-1-[6-[(3-Acetyl-2,4,6-Trihydroxy-5-Methylphenyl)Methyl]-5,7-Dihydroxy-2,2-Dimethylchromen-8-Yl]-3-Phenylprop-2-En-1-One	present	NPASS
1,7-Dihydroxy-2,3-Methylenedioxyxanthone	present	NPASS
2,5-Dideoxy-2,5-Imino-D-Glucitol	present	LOTUS
2,5-Dideoxy-2,5-Imino-D-Mannitol	present	NPASS
2-Octadec-9-enoylcyclohexane-1,3-dione	present	NPASS
4,5-Di-hydroxy-pipecolic acid	present	LOTUS

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Derris elliptica has left across the world's sequence archives.

At a glance

DNA specimens23

Marker genes4

GenBank sequences7

eDNA detections18

Countries5

The DNA barcodea real sequence read deposited for this species

ITSKJ579432.1 ↗694 bpMalaysia

ACGT

GGGGTGTAAATTGAAGCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTCAATCAATTCGACCTGTGAATTT …

Derris elliptica isolate tuba susu 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Derris elliptica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type199 records

Wild obs. + sensor62

Museum / vouchered137

Origin

Native4

Range

Area of Occupancy AOO516 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 20≤1 km 5>10 km 18

43 georeferenced · 19 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 4≤1 km 5≤10 km 3

12 georeferenced · 125 without coordinates

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	14
Nishihara, JP	13
Nishihara, JP	7
Odawara, JP	6
FFPRIlocation not on record	5
TAIElocation not on record	4
Taipei, TW	4
University of Stellenboschlocation not on record	3
Miami, US	3
Istituto Agrario Castelnuovolocation not on record	3
Cibinong Science Center, Herbarium Bogorienselocation not on record	3
CNF-UFHBlocation not on record	3
Taipei, TW	3
Guilin, CN	3
Zhuzhou, CN	3
LDlocation not on record	2
Honolulu, US	2
Burlington, US	2
Christchurch, NZ	2
Beijing, CN	2
Guangzhou, CN	2
Canberra, AU	1
La Trobe Universitylocation not on record	1
JBRJlocation not on record	1
BISHlocation not on record	1
St. Augustine, TT	1
Gujarat Biodiversity Gene Banklocation not on record	1
Montréal, CA	1
HAWlocation not on record	1
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	1
Université de Strasbourglocation not on record	1
Fort Worth, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Saint Louis, US	1
SCAUlocation not on record	1
Moscow State Universitylocation not on record	1
H. Balslevlocation not on record	1
Xiamen, CN	1
Brisbane, AU	1
Tampa, US	1
Kensington, AU	1
Museo Entomologico de Leonlocation not on record	1

42 institutions · 110 of 137 vouchered records shown · 21 without an institution code

09Environmental DNA18 detections

Where the DNA of Derris elliptica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.1 °C 25.7–28.1

Seasonal swing summer↔winter4.40 °C

Max temp (day)31.9 °C 28.8–31.9

Min temp (night)23.6 °C 22.4–23.6

Precipitation137 mm/mo 137–269

Air humidity59.8 % 59.8–69.8

Moisture balance-8.90 mm/mo -8.90–133

Vapour deficit1,523 Pa 1,001–1,523

Wind speed2.20 m/s 1.20–3.60

Cloud cover38.6 % 35.9–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)