Depressaria heydenii

Zeller, 1854 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Depressariidae/Depressaria

At a glance

Occurrence records69

Data sources7

Biological traits0

DNA specimens14

eDNA detections14

Sources7 archives

Databases and archives Depressaria heydenii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility69 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF69 records

Environmental DNA1 datasets · 4 countries14 detections

DNA & barcodingBOLD14 specimens

01Narrative

Depressaria heydenii is a moth of the family Depressariidae. It is found in France, Germany, Switzerland, Austria, Italy, Slovakia, Poland and Romania. It is an alpine species. Larval web in an umbel of Heracleum sphondylium ssp. austriacum Larva The larvae have been recorded feeding on Heracleum juranum, Heracleum austriacum, Heracleum sphondylium, Meum athamanticum and Laserpitium latifolium.lepiforum.de Young larvae are bright green with yellow length lines and a black head. Older larvae are darker green.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Depressaria heydenii has left across the world's sequence archives.

At a glance

DNA specimens14

BINs2

Marker genes1

eDNA detections14

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

40Amostly conserved

59Cmostly conserved

67Amostly conserved

92Cmostly conserved

115Tmostly conserved

160Gvariable

205Cmostly conserved

217Amostly conserved

220Cmostly conserved

235Tvariable

250Tmostly conserved

268Amostly conserved

274Cmostly conserved

340Cmostly conserved

355Cmostly conserved

376Cmostly conserved

403Amostly conserved

433Amostly conserved

463Tmostly conserved

478Cmostly conserved

484Cmostly conserved

505Amostly conserved

508Gmostly conserved

511Amostly conserved

514Cvariable

535Amostly conserved

539Tmostly conserved

544Cvariable

548Cvariable

550Amostly conserved

574Tmostly conserved

577Amostly conserved

583Cmostly conserved

610Cmostly conserved

628Avariable

634Tmostly conserved

637Amostly conserved

653Tmostly conserved

AACATTATATTTTATCTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTACTAATTCGAGCTGAATTAGGTAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes10

BINs2

Most divergent pair4.3%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Depressaria eryngiellasame genus5.5%Depressaria artemisiaesame genus5.8%Depressaria discipunctellasame genus6.1%Depressaria gallicellasame genus6.2%Depressaria veloxsame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type69 records

Wild obs. + sensor3

Museum / vouchered40

Other26

Range

Area of Occupancy AOO200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 2

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 1≤1 km 32≤10 km 2

35 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence40

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	32
Salzburg, AT	3
Philadelphia, US	2
Cornell University Insect Collectionlocation not on record	1

4 institutions · 38 of 40 vouchered records shown · 2 without an institution code

09Environmental DNA14 detections

Where the DNA of Depressaria heydenii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.60 °C 3.80–13.0

Seasonal swing summer↔winter19.2 °C

Max temp (day)12.0 °C 8.30–17.5

Min temp (night)1.60 °C -1.20–8.30

Precipitation172 mm/mo 111–336

Air humidity64.2 % 60.1–65.9

Moisture balance82.8 mm/mo 16.6–236

Vapour deficit384 Pa 301–559

Wind speed3.50 m/s 1.90–6.50

Cloud cover38.3 % 36.1–42.3

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)