Deplanchea tetraphylla

(R.Br.) F.Muell. ex Steenis · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Bignoniaceae/Deplanchea

At a glance

Occurrence records158

Data sources8

Biological traits25

DNA specimens3

eDNA detections2

Sources8 archives

Databases and archives Deplanchea tetraphylla's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility158 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF158 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Deplanchea tetraphylla is a species of tropical rainforest tree, commonly known as golden bouquet tree, wallaby wireless tree or yellow pagoda flower tree, constituting part of the plant family Bignoniaceae. It grows naturally in New Guinea, Aru Islands, Cape York Peninsula and the Wet Tropics of Queensland, north eastern Australia. Atop the branches, mature trees have spectacular large bouquets of many yellow flowers, hence popularly planted in wet–tropical Australian horticulture.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology7

Fruit length95 mm

Fruit width26 mm

Leaf length225 mm

Leaf width118 mm

Plant height20 m

Seed length14 mm

Seed width3.5 mm

Life cycle & reproduction6

Deciduousnessevergreen

Flowering timennnnnnyyyyyn

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density427 mg/cm³

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Deplanchea tetraphylla has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496405.1 ↗552 bpAustralia · 2013

ACGT

AGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAGGATACTGATATCTTGGCAGCA …

Deplanchea tetraphylla isolate BATT543-10 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type158 records

Wild obs. + sensor120

Museum / vouchered18

Other20

Range

Area of Occupancy AOO424 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 56≤1 km 22≤10 km 9>10 km 5

92 georeferenced · 28 without coordinates

Open the mapobservation + sensor120

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 18 records without

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	1
Australian Tropical Herbariumlocation not on record	1
Miami, US	1

3 institutions · 3 of 18 vouchered records shown · 14 without an institution code

09Environmental DNA2 detections

Where the DNA of Deplanchea tetraphylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.5 °C 22.0–23.0

Seasonal swing summer↔winter12.9 °C

Max temp (day)27.5 °C 26.7–28.3

Min temp (night)17.4 °C 15.5–19.3

Precipitation188 mm/mo 50.0–325

Air humidity56.5 % 46.0–67.0

Moisture balance34.9 mm/mo -107–177

Vapour deficit1,243 Pa 938–1,548

Wind speed3.30 m/s 2.80–3.90

Cloud cover40.9 % 22.6–59.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)