Denisia stipella

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Oecophoridae/Denisia

At a glance

Occurrence records5 652

Data sources9

Biological traits0

DNA specimens46

eDNA detections186

Sources9 archives

Databases and archives Denisia stipella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 652 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI186 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics46 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 652 records

Environmental DNA5 datasets · 9 countries186 detections

DNA & barcodingBOLD46 specimens

Genome at a glanceGoaT · NCBI≈600 Mbp

01Narrative

Denisia stipella is a moth of the family Oecophoridae. It is found in almost all of continental Europe, except the Iberian Peninsula and the southern part of the Balkan Peninsula. The wingspan is 14–19 mm. Adults are on wing from the end of May to August. The larvae live under dead bark, in decayed wood and amongst other plant material from conifers such as Abies alba, Picea and Pinus species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding46 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Denisia stipella has left across the world's sequence archives.

At a glance

DNA specimens46

BINs1

Marker genes1

eDNA detections186

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 39 variable positions, in barcode order

1Amostly conserved

49Cvariable

67Amostly conserved

109Avariable

157Cmostly conserved

217Gmostly conserved

220Tmostly conserved

268Amostly conserved

292Cvariable

317Gmostly conserved

335Gmostly conserved

352Tmostly conserved

373Tmostly conserved

406Cmostly conserved

421Amostly conserved

448Tmostly conserved

460Tmostly conserved

477Amostly conserved

478Tmostly conserved

479Amostly conserved

480Tmostly conserved

499Cmostly conserved

506Gmostly conserved

523Cmostly conserved

541Avariable

547Tmostly conserved

559Gvariable

568Tmostly conserved

571Tmostly conserved

577Amostly conserved

578Tmostly conserved

619Gvariable

625Gmostly conserved

628Avariable

631Amostly conserved

634Cmostly conserved

651Amostly conserved

652Tmostly conserved

655Amostly conserved

AACATTATACTTTATTTTTGGAATTTGGGCAGGAATAATTGGAACATCCTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes17

BIN1

Most divergent pair2.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Denisia rhaeticasame genus5.9%Denisia nubilosellasame genus5.9%Denisia haydenellasame genus6.1%Denisia luticiliellasame genus7.8%Schiffermuelleria grandissame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Denisia stipella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈600 210 954 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Denisia stipella0.60 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.5% BUSCO

08Occurrence & distribution

Record type5 652 records

Wild obs. + sensor3 826

Museum / vouchered1 795

Other31

Range

Area of Occupancy AOO8 176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 1 857≤1 km 829≤10 km 1 016>10 km 3

3 705 georeferenced · 121 without coordinates

Open the mapobservation + sensor3 826

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 459≤1 km 291≤10 km 697>10 km 37

1 484 georeferenced · 311 without coordinates

Open the institutions mapphysical evidence1 795

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	887
NHMOlocation not on record	165
DanishLepidopterologicalSocietylocation not on record	114
Tartu, EE	57
SLU Artdatabankenlocation not on record	55
Tromsø, NO	28
Stockholm, SE	26
Rovaniemi, FI	24
NTNU-VMlocation not on record	14
Tilburg, NL	14
Salzburg, AT	13
RMZlocation not on record	13
Metsähallituslocation not on record	12
Kuopio, FI	11
Nijmegen, NL	10
ZMAAlocation not on record	8
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	8
DABUHlocation not on record	6
Provincia di Livornolocation not on record	5
Natural History Museum Rotterdamlocation not on record	4
ZSMlocation not on record	3
NTNU University Museum, Department of Natural Historylocation not on record	3
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	2
BioFokuslocation not on record	2
University of Kaiserslauternlocation not on record	1
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Uniwersytet Łódzkilocation not on record	1
neflocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1

30 institutions · 1 490 of 1 795 vouchered records shown · 305 without an institution code

09Environmental DNA186 detections

Where the DNA of Denisia stipella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found186

Studies independent surveys5

Countries9

Verifiable raw sequence linked143

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 186 detections have coordinates

Open the map9 countries0

Alpine willow zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.0 °C 9.70–16.2

Seasonal swing summer↔winter21.2 °C

Max temp (day)16.1 °C 11.4–19.2

Min temp (night)8.70 °C 5.10–12.1

Precipitation103 mm/mo 60.4–164

Air humidity60.0 % 57.0–66.0

Moisture balance0.7 mm/mo -55.1–68.9

Vapour deficit600 Pa 410–746

Wind speed3.00 m/s 1.90–5.60

Cloud cover52.6 % 37.7–63.1

CHELSA 1981–2010, ~9 km grid, at location & month of 185 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Denisia stipella

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 652 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 652 records