Denhamia silvestris

(Lander & L.A.S.Johnson) M.P.Simmons · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Denhamia

At a glance

Occurrence records4 682

Data sources7

Biological traits43

DNA specimens4

eDNA detections3

Sources7 archives

Databases and archives Denhamia silvestris's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility4 682 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources43 traits

Occurrence & distributionGBIF4 682 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Maytenus silvestris is a shrub or small tree growing from Picton, New South Wales (34° S) near Kroombit Tops, near Gladstone, Queensland (23° S). It occurs in dry rainforest, eucalyptus and rainforest ecotone areas. Common names include narrow leaved orangebark, orange bush and orange bark.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology17

Fruit length5.25 mm

Fruit width5.75 mm

Leaf length45 mm

Leaf length max80 mm

Leaf length min10 mm

Leaf mass25 mg

Leaf mass per area105 g/m2

Leaf size237 mm²

Leaf width6.6 mm

Leaf width max15 mm

Leaf width min2 mm

Petiole length0.15 cm

Plant height4.5 m

⚠ sources differ — AusTraits: 4.5 m · TRY: 2 m

Plant height max4.5 m

Seed length4.33 mm

Seed mass13.89 mg

Seed width2.72 mm

Life cycle & reproduction12

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeanimal

Flowering endDec

Flowering startOct

Flowering timennnnnnnnnyyy

Life formshrub or tree

Life span>30

⚠ sources differ — TRY: >30 · AusTraits: perennial · GIFT: perennial

Lifespan years30 years

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapelanceolate narrowly_elliptical oblanceolate

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)9.47 mm²/mg

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Denhamia silvestris has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU328721.1 ↗643 bp

ACGT

TTGTCGAACCTGGAAGGCAAAAACGACCCGCGAATCTGTGGCAACTAACGTGGGGGGTGGGCCTCTCGGCCCGTCGCCCAAAGTCCTTGG …

Maytenus silvestris 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type4 682 records

Wild obs. + sensor4 089

Museum / vouchered483

Cultivated / captive3

Other107

Origin

Native171

Range

Area of Occupancy AOO9 852 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 3 665≤1 km 277≤10 km 44>10 km 12

3 998 georeferenced · 91 without coordinates

Open the mapobservation + sensor4 089

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 79≤1 km 55≤10 km 210>10 km 37

381 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence483

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	170
Brisbane, AU	96
Armidale, AU	74
Museo Entomologico de Leonlocation not on record	55
Canberra, AU	49
NSW Dept of Planning, Industry and Environmentlocation not on record	16
Wollongong, AU	8
Kew, GB	7
John T. Waterhouse Herbariumlocation not on record	2
Smithfield, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
James Cook Townsvillelocation not on record	1
Adelaide, AU	1

13 institutions · 482 of 483 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Denhamia silvestris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 19.2–19.2

Seasonal swing summer↔winter9.40 °C

Max temp (day)22.8 °C

Min temp (night)16.0 °C

Precipitation138 mm/mo

Air humidity61.6 %

Moisture balance21.6 mm/mo

Vapour deficit856 Pa

Wind speed2.20 m/s

Cloud cover24.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Denhamia silvestris

At a glance

Sources7 archives

Size & morphology17

Life cycle & reproduction12

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

At a glance

Record type4 682 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 13 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 682 records