Denhamia disperma

(F.Muell.) M.P.Simmons · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Denhamia

At a glance

Occurrence records943

Data sources9

Biological traits39

DNA specimens7

eDNA detections5

Sources9 archives

Databases and archives Denhamia disperma's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility943 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources39 traits

Chemical compositionLOTUS · NPASS68 compounds

Occurrence & distributionGBIF943 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Maytenus disperma, sometimes referred to as the orange boxwood, is a shrub or small tree growing in eastern Australia. Often seen in and near dry rainforests.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology14

Fruit length8 mm

Fruit width5.5 mm

Leaf length80 mm

Leaf length max90 mm

Leaf length min30 mm

Leaf width40 mm

Leaf width max40 mm

Leaf width min10 mm

Petiole length0.75 cm

Plant height11.5 m

Plant height max8 m

Seed length6 mm

Seed mass24.95 mg

Seed width3.5 mm

Life cycle & reproduction10

Dehiscencedehiscent

Dispersal typeanimal

Flowering endJan

Flowering startOct

Flowering timeynnnnnnnnyyy

Life formtree

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical oblong obovate

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density814 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition68 compounds

Compounds documented for Denhamia disperma across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Labdane diterpenoids9

Labdane diterpenoids $ Norlabdane diterpenoids5

Stigmastane steroids3

Cinnamic acids and derivatives3

Flavonols2

Documented compounds68 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,4As,8Ar)-5,5,8A-Trimethyl-4-Oxo-1-[(E)-2-(5-Oxo-2H-Furan-4-Yl)Ethenyl]-4A,6,7,8-Tetrahydro-1H-Naphthalene-2-Carbaldehyde	present	NPASS
(3E,5R)-3-[2-[(1S,4aS,8aS)-5,5,8a-trimethyl-2-methylidene-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]ethylidene]-5-hydroxyoxolan-2-one	present	NPASS
(3S,6E)-Nerolidol	present	NPASS
(4S,4aR,8aS)-4-[(Z)-2-(furan-3-yl)ethenyl]-3,4a,8,8-tetramethyl-5,6,7,8a-tetrahydro-4H-naphthalen-1-one	present	NPASS
(E)-4-[(1S,4aS,8aS)-5,5,8a-trimethyl-2-methylidene-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]-2-(2,2-diethoxyethyl)but-2-enal	present	NPASS
(E)-4-[(1S,4aS,8aS)-5,5,8a-trimethyl-2-methylidene-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]-2-(2-hydroxyethyl)but-2-enal	present	NPASS
1,7-Bis(4-hydroxy-3-methoxyphenyl)hepta-4,6-dien-3-one	present	NPASS
2-Propenal, 3-(4-hydroxy-3-methoxyphenyl)-	present	NPASS
2-Propenoic acid, 3-(4-hydroxy-3-methoxyphenyl)-, ethyl ester	present	NPASS
3-(4-Hydroxy-3-Methoxyphenyl)Prop-2-Enoic Acid	present	NPASS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Denhamia disperma has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences7

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU328723.1 ↗620 bp

ACGT

AAGGATCATTGTCGAAACCTGGAAGGCAAAACGACCCGCGAATCCGTGGCAACTAACGTGGGGGGTGGGCCTCTCGGCCTGTCGCCCAAA …

Maytenus disperma 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type943 records

Wild obs. + sensor175

Museum / vouchered400

Cultivated / captive1

Other367

Origin

Native27

Introduced1

Range

Area of Occupancy AOO2 556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 64≤1 km 14≤10 km 9>10 km 6

93 georeferenced · 82 without coordinates

Open the mapobservation + sensor175

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 83≤1 km 11≤10 km 238>10 km 42

374 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence400

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	166
Smithfield, AU	86
Museo Entomologico de Leonlocation not on record	57
Mount Annan, AU	23
Canberra, AU	19
Armidale, AU	15
James Cook Townsvillelocation not on record	9
Palmerston, AU	8
Adelaide, AU	6
Kew, GB	4
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1

12 institutions · 395 of 400 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Denhamia disperma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 21.0–21.8

Seasonal swing summer↔winter14.5 °C

Max temp (day)27.3 °C 26.4–28.2

Min temp (night)15.6 °C 15.1–16.2

Precipitation45.8 mm/mo 21.6–70.1

Air humidity50.0 % 44.7–55.4

Moisture balance-95.2 mm/mo -133–-57.4

Vapour deficit1,355 Pa 1,139–1,570

Wind speed3.40 m/s 2.90–3.90

Cloud cover22.1 % 18.9–25.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)