Denhamia cunninghamii

(Hook.) M.P.Simmons · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Denhamia

At a glance

Occurrence records2 513

Data sources6

Biological traits44

DNA specimens6

eDNA detections4

Sources6 archives

Databases and archives Denhamia cunninghamii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 513 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources44 traits

Occurrence & distributionGBIF2 513 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Maytenus cunninghamii is a species of shrub endemic to Australia. The natural range extends from The Kimberley and throughout The Northern Territory and Queensland. The plant grows to 6 metres in height, though it commonly flowers as a much smaller shrub. It is most commonly found in savanna and open forests, though it occasionally extends into monsoon forest. Flowers and foliage of M. cunninghamii.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsTRYGIFTWCVP

Size & morphology20

Fruit length5 mm

Fruit width4.5 mm

Leaf length70 mm

Leaf length max70 mm

Leaf length min20 mm

Leaf mass17 mg

Leaf mass per area169 g/m2

Leaf size88.9 mm²

Leaf width6.05 mm

Leaf width max8 mm

Leaf width min2 mm

Petiole length0.2 cm

Plant height4.5 m

⚠ sources differ — AusTraits: 4.5 m · TRY: 2 m

Plant height max4.5 m

Plant height min2 m

Seed length4.05 mm

Seed mass12.82 mg

Seed mass max12.82 mg

Seed mass min12.82 mg

Seed width3 mm

Life cycle & reproduction10

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeanimal

Flowering endApr

Flowering startOct

Flowering timeyyyynnnnnyyy

Life spanperennial

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapelinear narrowly_elliptical oblanceolate

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)5.25 mm²/mg

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Denhamia cunninghamii has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences5

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU328770.1 ↗665 bp

ACGT

ATTGTCGAACCTGGAAGGCAAACGACCCGCGAATCTGTGGCAACTAACGTGGGGGGTGGGCCTCTCGGCCCGTCGCCCAAAGTCCTTGGC …

Maytenus cunninghamii 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type2 513 records

Wild obs. + sensor1 188

Museum / vouchered906

Cultivated / captive2

Other417

Origin

Native120

Range

Area of Occupancy AOO7 252 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 887≤1 km 34≤10 km 31>10 km 5

957 georeferenced · 231 without coordinates

Open the mapobservation + sensor1 188

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 221≤1 km 97≤10 km 427>10 km 99

844 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence906

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	317
Museo Entomologico de Leonlocation not on record	113
Palmerston, AU	111
Canberra, AU	96
Mount Annan, AU	95
Smithfield, AU	86
Kew, GB	15
Kensington, AU	14
Armidale, AU	14
Adelaide, AU	13
NSW Dept of Planning, Industry and Environmentlocation not on record	12
James Cook Townsvillelocation not on record	8
Hobart, AU	3
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
NSW Office of Environment and Heritagelocation not on record	2
John T. Waterhouse Herbariumlocation not on record	1
University of Stellenboschlocation not on record	1

17 institutions · 903 of 906 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Denhamia cunninghamii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 20.1–20.9

Seasonal swing summer↔winter12.4 °C

Max temp (day)26.1 °C 25.7–26.5

Min temp (night)15.3 °C 14.9–15.7

Precipitation57.7 mm/mo 55.9–59.6

Air humidity54.5 % 54.4–54.5

Moisture balance-75.4 mm/mo -79.8–-71.0

Vapour deficit1,130 Pa 1,106–1,154

Wind speed3.30 m/s 3.20–3.30

Cloud cover25.9 % 25.6–26.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Denhamia cunninghamii

At a glance

Sources6 archives

Size & morphology20

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

At a glance

Record type2 513 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 513 records