Dendrosenecio keniensis

(Baker fil.) Mabb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Dendrosenecio

At a glance

Occurrence records208

Data sources8

Biological traits6

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Dendrosenecio keniensis's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility208 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF208 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 100

01Narrative

Dendrosenecio keniensis (syn. Senecio keniensis and S. brassica) is one of the giant groundsels endemic the higher altitudes of Mount Kenya. It is in the family Asteraceae and the genus Dendrosenecio (previously a Senecio). Dendrosenecio keniodendron occurs the upper alpine zone of Mount Kenya and D. keniensis in the wetter areas of the lower alpine or the moorlands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass1.87 mg

Life cycle & reproduction1

Life spanperennial

Habitat & environment3

Climatemontane tropical

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: herb/shrub

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · GIFT: woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrosenecio keniensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences5

The DNA barcodea real sequence read deposited for this species

rbcLNC_036832.1 ↗150 548 bp

ACGT

TTTATTAAAAAAAATAAATAAATTTGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGG …

Dendrosenecio keniensis chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL5

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Dendrosenecio keniensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 100 n = 50

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 501×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Knox, E. B. & R. R. Kowal. 1993. Chromosome numbers of the East African giant senecios and giant lobelias and their evolutionary significance. Amer. J. Bot. 80: 847–853.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type208 records

Wild obs. + sensor71

Museum / vouchered137

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 29≤1 km 12≤10 km 7>10 km 6

54 georeferenced · 17 without coordinates

Open the mapobservation + sensor71

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 9≤1 km 4≤10 km 3

16 georeferenced · 121 without coordinates

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	118
Kew, GB	8
Bloomington, US	8
National Museums of Kenyalocation not on record	2
Stockholm, SE	1

5 institutions · 137 of 137 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)