Dendrosenecio battiscombei

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Dendrosenecio

At a glance

Occurrence records166

Data sources8

Biological traits4

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Dendrosenecio battiscombei's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility166 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources4 traits

Occurrence & distributionGBIF166 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Dendrosenecio battiscombei (synonym Senecio battiscombei) is one of the giant groundsels that lives on the slopes of Mount Kenya and the Aberdare Range. Like Dendrosenecio adnivalis on the Ruwenzori Mountains and the Virunga Mountains, Dendrosenecio battiscombei grows in the lower wetter areas of the Afro-Alpine zone.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life spanperennial

Habitat & environment3

Climatemontane tropical

Growth formtree

⚠ sources differ — GIFT: tree · TRY: herb

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrosenecio battiscombei has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences10

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLMK756016.1 ↗150 540 bp

ACGT

TTTATTAAAAAAAATAAATAAATTTGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGG …

Dendrosenecio battiscombei voucher F12-8 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL10ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type166 records

Wild obs. + sensor17

Museum / vouchered149

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 7≤1 km 1≤10 km 1>10 km 3

12 georeferenced · 5 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 18≤1 km 3≤10 km 14>10 km 14

49 georeferenced · 100 without coordinates

Open the institutions mapphysical evidence149

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	90
Kew, GB	32
Bloomington, US	27

3 institutions · 149 of 149 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Dendrosenecio battiscombei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.