Dendrosenecio adnivalis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Dendrosenecio

At a glance

Occurrence records33

Data sources7

Biological traits4

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Dendrosenecio adnivalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility33 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF33 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 100

01Narrative

D. adnivalis (left) and lobelia on Rwenzori Dendrosenecio adnivalis (synonym Senecio adnivalis) is one of the giant groundsels of the mountains of Eastern Africa. D. adnivalis grows on the Rwenzori Mountains and on the Virunga Mountains in Uganda and the Democratic Republic of Congo.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction1

Life spanperennial

Habitat & environment3

Climatemontane tropical

Growth formtree

Woodinesswoody

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrosenecio adnivalis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences6

The DNA barcodea real sequence read deposited for this species

rbcLMK756015.1 ↗150 539 bp

ACGT

TTTATTAAAAAAAATAAATTTGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTAC …

Dendrosenecio adnivalis voucher J27-23 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL6

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Dendrosenecio adnivalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 100 n = 50

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 502×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Knox, E. B. & R. R. Kowal. 1993. Chromosome numbers of the East African giant senecios and giant lobelias and their evolutionary significance. Amer. J. Bot. 80: 847–853.

08Occurrence & distribution

Record type33 records

Wild obs. + sensor9

Museum / vouchered24

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 3≤1 km 4≤10 km 2

9 georeferenced

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 24 records without

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Olocation not on record	24

1 institutions · 24 of 24 vouchered records shown