Dendrophthoe vitellina

(F.Muell.) Tiegh. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Santalales/Loranthaceae/Dendrophthoe

At a glance

Occurrence records1 831

Data sources10

Biological traits18

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Dendrophthoe vitellina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 831 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources18 traits

Occurrence & distributionGBIF1 831 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT4.7 Gbp

01Narrative

Dendrophthoe vitellina, commonly known as long-flowered- or apostle mistletoe, is a hemiparasitic plant of the mistletoe family Loranthaceae. The genus Dendrophthoe comprises about 31 species spread across tropical Africa, Asia, and Australia. Despite being collected by Joseph Banks and Daniel Solander in 1788, and depicted in Banks' Florilegium, it was not until 1860 that it was described by Ferdinand von Mueller as Loranthus vitellinus after being collected near Ipswich, and renamed by Philippe Édouard Léon Van Tieghem in 1895.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraits

Size & morphology4

Fruit length12.5 mm

Leaf length140 mm

Leaf width30 mm

Petiole length0.75 cm

Life cycle & reproduction6

Dispersal typeanimal

Flowering timeyynnnnnnyyyy

Life spanperennial

Pollination syndromeinsect+vertebrate

Resprouting capacityfire_killed

Sex typehermaphrodite

Habitat & environment6

Fruit fleshinessfleshy

Fruit typeberry

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical narrowly_lanceolate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrophthoe vitellina has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences2

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSDQ333839.1 ↗584 bp

ACGT

AAACAACCGAGCGACCCGTGGACATGTTCGATCGAAGGGGCGGGAGAGAGGGCTTGCCCGATCCCCCCCCGGAGCCCGCGCGCTTGCGAG …

Dendrophthoe vitellina internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Dendrophthoe vitellina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 694 400 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Dendrophthoe vitellina4.69 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×GoaT · Kew Plant DNA C-values Database · CCDB · iapt

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · iapt — IAPT/IOPB Chromosome Data 35

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type1 831 records

Wild obs. + sensor1 228

Museum / vouchered574

Other29

Origin

Native166

Range

Area of Occupancy AOO4 496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 886≤1 km 164≤10 km 48>10 km 19

1 117 georeferenced · 111 without coordinates

Open the mapobservation + sensor1 228

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 106≤1 km 52≤10 km 231>10 km 76

465 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence574

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	165
Brisbane, AU	151
Canberra, AU	70
Museo Entomologico de Leonlocation not on record	57
Smithfield, AU	42
Armidale, AU	15
Adelaide, AU	14
NSW Dept of Planning, Industry and Environmentlocation not on record	6
James Cook Townsvillelocation not on record	6
John T. Waterhouse Herbariumlocation not on record	6
Kew, GB	6
Parkville, AU	3
Palmerston, AU	3
Wellington, NZ	1
Hobart, AU	1
University of Alberta Museumslocation not on record	1
Batemans Bay, AU	1
Departamento de Sistematica e Ecologialocation not on record	1

18 institutions · 549 of 574 vouchered records shown · 24 without an institution code

09Environmental DNA3 detections

Where the DNA of Dendrophthoe vitellina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 22.7–29.4

Seasonal swing summer↔winter16.1 °C

Max temp (day)32.6 °C 29.3–35.9

Min temp (night)18.3 °C 15.7–21.0

Precipitation9.20 mm/mo 4.10–14.3

Air humidity42.1 % 41.1–43.1

Moisture balance-167 mm/mo -186–-147

Vapour deficit2,085 Pa 1,716–2,454

Wind speed3.40 m/s 2.90–3.90

Cloud cover17.6 % 17.2–18.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dendrophthoe vitellina

At a glance

Sources10 archives

Size & morphology4

Life cycle & reproduction6

Habitat & environment6

Physiology & chemistry2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 831 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 831 records