Dendrophorbium peregrinum

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Dendrophorbium

At a glance

Occurrence records37

Data sources3

Biological traits9

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Dendrophorbium peregrinum's data was compiled from.

GBIFGlobal Biodiversity Information Facility37 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources9 traits

Occurrence & distributionGBIF37 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesGIFT

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max800 m

Elevation min400 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrophorbium peregrinum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMW533406.1 ↗540 bpUSA · 2020

ACGT

CGAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAGGATACTGATATCTTGGCAG …

Dendrophorbium peregrinum isolate DNAS-567-70IO ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL2

plant barcode

08Occurrence & distribution

Record type37 records

Wild obs. + sensor20

Museum / vouchered17

Origin

Native2

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 9≤1 km 6≤10 km 1>10 km 1

17 georeferenced · 3 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 17 records without

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Córdoba, AR	7
University of Stellenboschlocation not on record	4
Ciudad Autónoma de Buenos Aires, AR	2
Stockholm, SE	1
Saint Louis, US	1

5 institutions · 15 of 17 vouchered records shown · 2 without an institution code