Dendromecon harfordii

Kellogg · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Papaveraceae/Dendromecon

At a glance

Occurrence records403

Data sources11

Biological traits13

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Dendromecon harfordii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility403 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF403 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 56

01Narrative

Dendromecon harfordii, known by the common names Channel Islands tree poppy and Harford's tree poppy, is a species of flowering plant in the poppy family. It was formerly treated as subspecies of the related species Dendromecon rigida, and had the botanical name Dendromecon rigida subsp. harfordii.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass16.73 mg

Seed mass max16.73 mg

Seed mass min16.73 mg

Life cycle & reproduction2

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendromecon harfordii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJF892633.1 ↗595 bpUSA

ACGT

GAAACCTGCACACGCAGAAGACCCGCGAACTCGTAATCTGAACCGGCGGCGGGGGGTCCCTCCCCAGCAGAGGGGCCCTCCCGTTGCCAC …

Dendromecon harfordii isolate E179 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dendromecon harfordii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 56 n = 28

Chromosome records56–562n range56median56mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 562×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Lenz 1950

CCDB · book-atlas-flowering-plants — Lenz 1950

08Occurrence & distribution

Record type403 records

Wild obs. + sensor199

Museum / vouchered204

Range

Area of Occupancy AOO372 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 111≤1 km 19≤10 km 13>10 km 8

151 georeferenced · 48 without coordinates

Open the mapobservation + sensor199

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 1≤1 km 78≤10 km 33>10 km 14

126 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence204

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara, US	85
San Diego, US	22
US	14
CASlocation not on record	10
Riverside, US	8
Los Angeles, US	8
San Luis Obispo, US	6
Catalina Island Conservancylocation not on record	5
Davis, US	5
Long Beach, US	5
Northridge, US	4
Claremont, US	3
Arcata, US	2
Canadian Department of Agriculturelocation not on record	2
Severin-McDaniel Insect Collectionlocation not on record	2
Wuzhou, CN	1
Flagstaff, US	1
Chadron, US	1
ASUlocation not on record	1

19 institutions · 185 of 204 vouchered records shown · 19 without an institution code

09Environmental DNA2 detections

Where the DNA of Dendromecon harfordii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)