Dendrolobium triangulare

(Retz.) Schindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Dendrolobium

At a glance

Occurrence records714

Data sources10

Biological traits29

DNA specimens3

eDNA detections2

Sources10 archives

Databases and archives Dendrolobium triangulare's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility714 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources29 traits

Occurrence & distributionGBIF714 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Dendrolobium triangulare is a species of flowering plants in the legume family, Fabaceae. It is found in Taiwan, China, Cambodia, India, Laos, Malaysia, Myanmar, Nepal, Sri Lanka, Thailand, Vietnam and few African countries. Leaves are trifoliate, where blade narrowly obovo-elliptic. Flowers white or pale yellow. Seed elliptic. Roots of the plant are widely used for medicinal purposes to strengthen bones and build muscle.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology5

Leaf size1 125 mm²

Plant height2 m

Seed mass10.11 mg

Seed mass max10.11 mg

Seed mass min10.11 mg

Life cycle & reproduction3

Deciduousnessdeciduous

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 650 m

Elevation min600 m

Growth form detailedsubshrub

Leaf formelliptic

Woodinesswoody

Physiology & chemistry6

Leaf c452 mg/g

Leaf dry-matter content (LDMC)470 mg/g

Leaf n31.32 mg/g

Leaf p1.56 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)12.9 mm²/mg

⚠ sources differ — TRY: 12.9 mm²/mg · GIFT: 14.64 mm²/mg

Other traits6

Leaf marginentire

Leaf spinesno

Leaf thornsno

Plant support typefree-standing

Sla max14.82 mm²/mg

Sla min14.46 mm²/mg

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrolobium triangulare has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences9

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW355100.1 ↗267 bp

ACGT

GATGGCCCGCAACCAGGCTGACCGGCGAACGCGTTCACCTGACCGACGGGGGCCGGGTCCCGCCCGGCCCCCCCCGCCGAGGGGCGGTCG …

Dendrolobium triangulare isolate Dbt4 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL★ITS9★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dendrolobium triangulare carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 227×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-indian_vol1 +1

CCDB · ipcn-api-dl — Kumar, M. G. V. & P. I. Kuriachan. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 145–147.

CCDB · ipcn-api-dl — Bairiganjan, G. C. & S. N. Patnaik. 1989. Chromosomal evolution in Fabaceae. Cytologia 54: 51–64.

CCDB · ipcn-api-dl — Gao, C. z. & Q. l. Zou. 1995. A report on the karyotypes and chromosome numbers of some taxa of Desmodium (sensu lat.) from Guangxi. Guihaia 15(2): 166–171.

CCDB · ipcn-api-dl — Sanjappa, M. & R. P. Bhatt. 1976. In IOPB chromosome number reports LIII. Taxon 25: 483–500.

CCDB · book-ipcn75-78 — Sanjappa & Bhatt 1976

CCDB · book-indian_vol1 — Sanjappa, M. & Bhatt, R.P~ 1977

CCDB · eflora

n 114×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · Cannon, 2015

CCDB · ipcn-api-dl — Kumar, M. G. V. & P. I. Kuriachan. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 145–147.

CCDB · ipcn-api-dl — Sanjappa, M. & R. P. Bhatt. 1977. In IOPB chromosome number reports LVI. Taxon 26: 257–274.

CCDB · book-ipcn75-78 — Sanjappa & Bhatt 1977

CCDB · Cannon, 2015 — Bairiganjan, G. C. & S. N. Patnaik, 1989

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type714 records

Wild obs. + sensor51

Museum / vouchered562

Cultivated / captive43

Other58

Range

Area of Occupancy AOO1 068 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 15≤1 km 6≤10 km 7>10 km 6

34 georeferenced · 17 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 559 without coordinates

Open the institutions mapphysical evidence562

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 43 records without

Open the mapnot free-living43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	121
Kunming, CN	103
Beijing, CN	90
Guilin, CN	52
Taipei, TW	33
Xiamen, CN	27
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	25
Taipei, TW	14
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	11
Yunnan Universitylocation not on record	11
Kew, GB	8
CASlocation not on record	7
Chengdu, CN	6
Paris, FR	5
Guiyang, CN	4
Herbarium of the Department of Botany, University of Tokyolocation not on record	4
Southwest Forestry Collegelocation not on record	3
Bronx, US	3
Taipei, TW	3
Edinburgh, GB	3
South China Normal Universitylocation not on record	3
University of Stellenboschlocation not on record	2
Chengdu, CN	2
Guizhou Forestry Schoollocation not on record	2
NGCPR01765location not on record	1
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	1
hitbclocation not on record	1
NGCPR01375location not on record	1
Central China Normal Universitylocation not on record	1
Seoul, KR	1
NGCPR01766location not on record	1
Guiyang, CN	1

32 institutions · 550 of 562 vouchered records shown · 12 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Dendrolobium triangulare was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)