Dendrocnide sinuata

(Blume) Chew · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Dendrocnide

At a glance

Occurrence records310

Data sources7

Biological traits33

DNA specimens10

eDNA detections5

Sources7 archives

Databases and archives Dendrocnide sinuata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility310 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF310 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Dendrocnide sinuata (meaning "tree nettle" with "wavy leaf margin" in Greek) is a poisonous plant called pulutus, pulus, stinging tree, fever nettle, or elephant nettle, growing in subtropical wet evergreen forests throughout Asia. Some of its uses in herbal medicine have been scientifically validated.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology13

Fruit length4.5 mm

⚠ sources differ — AusTraits: 4.5 mm · GIFT: 5.5 mm

Fruit length max6 mm

Fruit length min5 mm

Leaf length275 mm

Leaf length max450 mm

Leaf length min100 mm

Leaf width125 mm

Leaf width max200 mm

Leaf width min50 mm

Petiole length8.5 cm

Plant height5 m

⚠ sources differ — GIFT: 5 m · AusTraits: 10 m · TRY: 6 m

Plant height max10 m

Plant height min3 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation mean550 m

Elevation min300 m

Epiphyteobligatory

Fruit typeachene

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: tree · TRY: Herb

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinessnon-woody

⚠ sources differ — TRY: non-woody · AusTraits: woody · GIFT: woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)163 mg/g

Photosynthetic pathwayC3

Wood density341 mg/cm³

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrocnide sinuata has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOM892751.1 ↗5 794 bp

ACGT

ACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAAGTATGAACTAATTCAGACTGTGAAACTGC …

Dendrocnide sinuata isolate J7885 18S small subunit ribosomal RNA gene, partial sequence; and internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 26S large subunit ribosomal RNA gene, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL6★ITS2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type310 records

Wild obs. + sensor192

Museum / vouchered118

Origin

Native5

Range

Area of Occupancy AOO440 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 62≤1 km 103≤10 km 13>10 km 2

180 georeferenced · 12 without coordinates

Open the mapobservation + sensor192

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤1 km 2≤10 km 7

9 georeferenced · 109 without coordinates

Open the institutions mapphysical evidence118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	26
Kew, GB	7
Guangzhou, CN	6
Mount Annan, AU	5
Pondicherry, IN	4
Cibinong Science Center, Herbarium Bogorienselocation not on record	3
Edinburgh, GB	2
Canberra, AU	2
Museo Entomologico de Leonlocation not on record	2
Guilin, CN	2
Saint Louis, US	1
University of Stellenboschlocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1
Kunming, CN	1
Kensington, AU	1

16 institutions · 65 of 118 vouchered records shown · 52 without an institution code

09Environmental DNA5 detections

Where the DNA of Dendrocnide sinuata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.0 °C 20.0–26.1

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C 23.9–29.7

Min temp (night)22.4 °C 15.2–22.6

Precipitation269 mm/mo 205–321

Air humidity68.1 % 66.4–69.2

Moisture balance133 mm/mo 94.6–183

Vapour deficit1,046 Pa 778–1,080

Wind speed1.20 m/s 0.8–1.60

Cloud cover57.5 % 47.8–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)