Dendrocnide moroides

(Wedd.) Chew · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Dendrocnide

At a glance

Occurrence records785

Data sources9

Biological traits39

DNA specimens3

eDNA detections1

Sources9 archives

Databases and archives Dendrocnide moroides's data was compiled from.

WikipediaWikimedia Foundation16 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility785 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources39 traits

Chemical compositionLOTUS · NPASS15 compounds

Occurrence & distributionGBIF785 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Dendrocnide moroides, commonly known in Australia as the stinging tree, stinging bush or gympie-gympie, is a plant in the nettle family Urticaceae found in rainforest areas of Malesia and Australia. It is notorious for its extremely painful and long-lasting sting. The common name gympie-gympie comes from the language of the Indigenous Gubbi Gubbi people of south-eastern Queensland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology18

Fruit length2 mm

Fruit width1.5 mm

Leaf length175 mm

Leaf length max250 mm

Leaf length min100 mm

Leaf mass per area52 g/m2

Leaf size38 427 mm²

Leaf width140 mm

Leaf width max200 mm

Leaf width min80 mm

Petiole length15 cm

Plant height4 m

Plant height max4 m

Seed length0.5 mm

Seed mass0.77 mg

⚠ sources differ — AusTraits: 0.77 mg · GIFT: 0.71 mg

Seed mass max0.77 mg

Seed mass min0.65 mg

Seed width0.5 mm

Life cycle & reproduction8

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeyyynnnnnnnyy

Life formshrub or tree

Life spanperennial

Pollination syndromewind

Resprouting capacityresprouts

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapepeltate widely_ovate

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition15 compounds

Compounds documented for Dendrocnide moroides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Cembrane diterpenoids12

Cyclic peptides3

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3S,4R,7R,8R,11R,12R)-3,8,11-trihydroxy-4,8,12-trimethyl-15-methylidene-13,18-dioxatricyclo[10.3.2.14,7]octadecan-14-one	present	NPASS
(1R,3S,4R,7R,8R,12R)-3,8-dihydroxy-4,8,12-trimethyl-15-methylidene-13,18-dioxatricyclo[10.3.2.14,7]octadecane-11,14-dione	present	NPASS
(8R,9S,12S,15S,18R,21S,27S)-21-[3-(diaminomethylideneamino)propyl]-12-(2-methylpropyl)-10,13,16,19,22,25-hexaoxo-9-[[(2S)-5-oxopyrrolidine-2-carbonyl]amino]-8,15-di(propan-2-yl)-2,11,14,17,20,23,26,30,32-nonazapentacyclo[16.14.2.13,7.129,32.04,33]hexatriaconta-1(33),3,5,7(36),29(35),30-hexaene-27-carboxylic acid	present	LOTUS
11-epi-Sinulariolide	present	NPASS
12-Butan-2-yl-21-[3-(diaminomethylideneamino)propyl]-10,13,16,19,22,25-hexaoxo-9-[(5-oxopyrrolidine-2-carbonyl)amino]-8,15-di(propan-2-yl)-2,11,14,17,20,23,26,30,32-nonazapentacyclo[16.14.2.13,7.129,32.04,33]hexatriaconta-1(33),3,5,7(36),29(35),30-hexaene-27-carboxylic acid	present	LOTUS
[(1R,3S,4R,7R,8R,11R,12R)-3,8-dihydroxy-4,8,12-trimethyl-15-methylidene-14-oxo-13,18-dioxatricyclo[10.3.2.14,7]octadecan-11-yl] acetate	present	NPASS
[(1R,3S,4R,7R,8R,11R,12R)-3-acetyloxy-8-hydroxy-4,8,12-trimethyl-15-methylidene-14-oxo-13,18-dioxatricyclo[10.3.2.14,7]octadecan-11-yl] acetate	present	NPASS
[(1R,3S,4R,7R,8R,12R)-8-hydroxy-4,8,12-trimethyl-15-methylidene-11,14-dioxo-13,18-dioxatricyclo[10.3.2.14,7]octadecan-3-yl] acetate	present	NPASS
[(1R,3S,4R,7S,8S,12R)-3-hydroxy-4,8,12-trimethyl-15-methylidene-11,14-dioxo-13,18-dioxatricyclo[10.3.2.14,8]octadecan-7-yl] acetate	present	NPASS
[(1R,3S,5S,7E,9R,12R,13R)-9-hydroxy-5,9,13-trimethyl-16-methylidene-15-oxo-4,14-dioxatricyclo[11.3.2.03,5]octadec-7-en-12-yl] acetate	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrocnide moroides has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKU564790.1 ↗573 bpAustralia · 2013

ACGT

AAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTACACTCCTGAATATGAAACCAAAGATACCGATATCTTAGCAGC …

Dendrocnide moroides ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type785 records

Wild obs. + sensor493

Museum / vouchered224

Cultivated / captive3

Other65

Origin

Native19

Introduced1

Range

Area of Occupancy AOO1 524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 240≤1 km 88≤10 km 34>10 km 24

386 georeferenced · 107 without coordinates

Open the mapobservation + sensor493

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 37≤1 km 28≤10 km 80>10 km 28

173 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence224

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 2 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	76
Smithfield, AU	68
Museo Entomologico de Leonlocation not on record	25
Mount Annan, AU	18
Canberra, AU	10
Palmerston, AU	4
Adelaide, AU	3
James Cook Townsvillelocation not on record	2
Armidale, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Hobart, AU	1
Paris, FR	1
St. Paul, US	1

13 institutions · 212 of 224 vouchered records shown · 12 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Dendrocnide moroides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 13.6–13.6

Seasonal swing summer↔winter10.6 °C

Max temp (day)18.9 °C

Min temp (night)9.20 °C

Precipitation41.8 mm/mo

Air humidity58.4 %

Moisture balance-18.4 mm/mo

Vapour deficit643 Pa

Wind speed1.90 m/s

Cloud cover26.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)