Dendrocnide excelsa

(Wedd.) Chew · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Dendrocnide

At a glance

Occurrence records3 079

Data sources8

Biological traits38

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Dendrocnide excelsa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 079 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources38 traits

Occurrence & distributionGBIF3 079 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Dendrocnide excelsa, commonly known as the giant stinging tree or fibrewood, is a rainforest tree in the family Urticaceae which is endemic to eastern Australia. It occurs from Tathra, New South Wales to Imbil in southeastern Queensland, and is very common at Dorrigo National Park and other rainforest walks in eastern Australia. The habitat of the giant stinging tree is subtropical, warm temperate or littoral rainforest, particularly in disturbed areas, previously flattened by storms or cyclones.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology15

Fruit length2 mm

Fruit width2 mm

Leaf length175 mm

Leaf length max250 mm

Leaf length min100 mm

Leaf mass per area76.54 g/m2

Leaf width150 mm

Leaf width max200 mm

Leaf width min70 mm

Petiole length7.5 cm

Plant height25 m

⚠ sources differ — GIFT: 25 m · AusTraits: 40 m · TRY: 22 m

Plant height max40 m

Seed length0.75 mm

Seed mass0.533 mg

⚠ sources differ — TRY: 0.533 mg · AusTraits: 0.457 mg

Seed width0.75 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeyynnnnnnnnny

Life formtree

Life spanperennial

Pollination syndromeabiotic

Resprouting capacityfire_killed

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formtree

Leaf compoundnesssimple

Leaf shapeorbicular widely_ovate

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density198 mg/cm³

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrocnide excelsa has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ182838.1 ↗391 bpAustralia · 2011

ACGT

ATACTTGGTGTGAATTGCAGGATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCC …

Dendrocnide excelsa voucher BRI AQ789665 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type3 079 records

Wild obs. + sensor2 847

Museum / vouchered154

Cultivated / captive3

Other75

Origin

Native43

Introduced2

Range

Area of Occupancy AOO5 748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 2 151≤1 km 188≤10 km 117>10 km 45

2 501 georeferenced · 346 without coordinates

Open the mapobservation + sensor2 847

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 23≤1 km 20≤10 km 48>10 km 27

118 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence154

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 2 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	42
Brisbane, AU	26
Museo Entomologico de Leonlocation not on record	21
Canberra, AU	21
Armidale, AU	16
NSW Dept of Planning, Industry and Environmentlocation not on record	5
Batemans Bay, AU	3
Smithfield, AU	3
Kew, GB	2
Wollongong, AU	2
Adelaide, AU	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
James Cook Townsvillelocation not on record	1
Palmerston, AU	1

14 institutions · 146 of 154 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Dendrocnide excelsa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.7 °C 19.7–19.7

Seasonal swing summer↔winter10.3 °C

Max temp (day)24.1 °C

Min temp (night)15.9 °C

Precipitation120 mm/mo

Air humidity60.4 %

Moisture balance7.80 mm/mo

Vapour deficit913 Pa

Wind speed2.00 m/s

Cloud cover25.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dendrocnide excelsa

At a glance

Sources8 archives

Size & morphology15

Life cycle & reproduction9

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

At a glance

Record type3 079 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 14 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 079 records