Dendrocnide cordata

(Warb. ex H.J.P.Winkl.) Chew · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Urticaceae/Dendrocnide

At a glance

Occurrence records29

Data sources7

Biological traits18

DNA specimens9

eDNA detections6

Sources7 archives

Databases and archives Dendrocnide cordata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility29 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources18 traits

Occurrence & distributionGBIF29 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Dendrocnide cordata là loài thực vật có hoa trong họ Tầm ma. Loài này được Chew mô tả khoa học đầu tiên năm 1965.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology8

Fruit length2 mm

Fruit width1.5 mm

Leaf length105 mm

Leaf mass per area22.99 g/m2

Leaf width105 mm

Plant height2 m

Seed length0.5 mm

Seed width0.5 mm

Life cycle & reproduction3

Life formtree

Life spanperennial

Sex typemonoecious

Habitat & environment6

Climatewet tropical

Fruit fleshinessdry

Fruit typeachene

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub

Leaf compoundnesssimple

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrocnide cordata has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences9

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK911057.1 ↗595 bp

ACGT

TAGAAACCTGCCAAGCAGCACGACCCGCGAACCCGTTTAACAATCACCTTACGGAGGCGAGTGCGGCGGGGAAATCCCCACGCGCTTGGC …

Dendrocnide cordata isolate Dt_684 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL7★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type29 records

Museum / vouchered28

Other1

Origin

Native3

Range

Area of Occupancy AOO76 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤1 km 1≤10 km 10

11 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence28

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	5
University of Minnesotalocation not on record	4
Mount Annan, AU	3
St. Paul, US	3
Museo Entomologico de Leonlocation not on record	1
Kew, GB	1
Honolulu, US	1
Palmerston, AU	1
Canberra, AU	1

9 institutions · 20 of 28 vouchered records shown · 7 without an institution code

09Environmental DNA6 detections

Where the DNA of Dendrocnide cordata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 22.6–23.2

Seasonal swing summer↔winter2.30 °C

Max temp (day)27.3 °C 25.4–27.8

Min temp (night)18.8 °C 18.6–20.7

Precipitation114 mm/mo 104–341

Air humidity63.5 % 63.3–74.2

Moisture balance-32.6 mm/mo -36.5–252

Vapour deficit1,010 Pa 715–1,040

Wind speed4.00 m/s 2.10–4.20

Cloud cover46.2 % 44.0–49.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)