Dendrocalamus longispathus

(Kurz) Kurz · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Dendrocalamus

At a glance

Occurrence records5

Data sources10

Biological traits13

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Dendrocalamus longispathus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF5 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 70

01Narrative

Dendrocalamus longispathus, the long-sheath bamboo, is a bamboo species which grows up to 20 m tall. It is native to Bangladesh, Myanmar, and Thailand. It has now become an exotic species all over the South Asia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height15 m

Plant height max20 m

Life cycle & reproduction3

Deciduousnessdeciduous

⚠ sources differ — TRY: deciduous · GIFT: evergreen

Life formbamboo

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrocalamus longispathus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH916750.1 ↗718 bpIndia

ACGT

TGGAAGTAAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGCCGTGACCCTACCGACCGAGCAGACCGCGAACGC …

Dendrocalamus longispathus isolate Dl02 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL6★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dendrocalamus longispathus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 70 n = 35

Ploidydiploid inferred

Chromosome records70–722n range71median70mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 701×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ghorai, A. & A. Sharma. 1980. Cytotaxonomy of Indian Bambuseae II. Dendrocalameae and I Melocanneae. Acta Bot. Indica 134–138.

2n 721×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — E.K.J.*

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type5 records

Wild obs. + sensor1

Museum / vouchered4

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	1
Gujarat Biodiversity Gene Banklocation not on record	1
Madhya Pradesh Council of Science & Technologylocation not on record	1

3 institutions · 3 of 4 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Dendrocalamus longispathus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 21.4–27.6

Seasonal swing summer↔winter11.9 °C

Max temp (day)30.0 °C 28.1–31.8

Min temp (night)18.9 °C 14.7–23.0

Precipitation33.8 mm/mo 23.7–43.9

Air humidity51.6 % 48.7–54.5

Moisture balance-98.7 mm/mo -109–-88.9

Vapour deficit1,497 Pa 1,317–1,676

Wind speed2.40 m/s

Cloud cover11.5 % 6.10–16.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)