Dendrocalamus hamiltonii

Nees & Arn. ex Munro · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Dendrocalamus

At a glance

Occurrence records47

Data sources11

Biological traits17

DNA specimens6

eDNA detections4

Sources11 archives

Databases and archives Dendrocalamus hamiltonii's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility47 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF47 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB · GoaT1.3 Gbp

01Narrative

Dendrocalamus hamiltonii, or Hamilton's bamboo, is a species of bamboo, 12–15 cm in diameter and growing up to 15–18 m in height, found in South Asian countries such as, India, Sri Lanka, Bhutan, Nepal, Pakistan, and far eastern China.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height15 m

⚠ sources differ — GIFT: 15 m · TRY: 18 m

Life cycle & reproduction5

Deciduousnessevergreen

Flowering endvariable

Flowering startvariable

Life formbamboo

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatesubtropical

Climberself-supporting

Elevation max1 500 m

Elevation mean750 m

Elevation min300 m

Epiphyteterrestrial

Growth formherb

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrocalamus hamiltonii has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPX892992.1 ↗351 bpIndia · 2024

ACGT

GATCCATTGCCGTTGACCCTACACCAAAGCAGACCGCGAACACGTCACCCCTCCCCCCGGGGGGCACCCCCCCGGCCGCCGGCCGGACCT …

Dendrocalamus hamiltonii voucher SCRIPCOG88DH internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL7★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Dendrocalamus hamiltonii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 328 782 653 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dendrocalamus hamiltonii1.33 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 70 n = 35

Ploidy10× 10× · measured

Chromosome records70–702n range70median70mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 702×GoaT · Kew Plant DNA C-values Database · CCDB · book-indian_vol2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-indian_vol2 — Mehra, P.N. & Sharma, M.L. 1972, 1975e

n 355×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Mehra, P. N. 1982. Cytology of East Indian grasses. ý.

CCDB · ipcn-api-dl — Kalia, V. & P. N. Mehra. 1986. Cytological studies in some bamboos of north-east India. J. Tree Sci. 5: 23–25.

CCDB · book-ipcn72 — MEHRA, P.N., & M.L. SHARMA. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.

CCDB · book-ipcn75-78 — Mehra & Sharma 1975d

CCDB · book-ipcn75-78 — Kalia 1978

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

10×1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type47 records

Wild obs. + sensor10

Museum / vouchered37

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 2≤1 km 1>10 km 1

4 georeferenced · 6 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤1 km 3≤10 km 1>10 km 6

10 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Southwest Forestry Collegelocation not on record	16
Natural History Museum, Tribhuvan Universitylocation not on record	10
Kew, GB	3
Gujarat Biodiversity Gene Banklocation not on record	2
Madhya Pradesh Council of Science & Technologylocation not on record	1
Saint Louis, US	1
Servico de Microbiologia e Imunologialocation not on record	1

7 institutions · 34 of 37 vouchered records shown · 3 without an institution code

09Environmental DNA4 detections

Where the DNA of Dendrocalamus hamiltonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.5 °C 21.4–27.6

Seasonal swing summer↔winter11.9 °C

Max temp (day)30.0 °C 28.1–31.8

Min temp (night)18.9 °C 14.7–23.0

Precipitation33.8 mm/mo 23.7–43.9

Air humidity51.6 % 48.7–54.5

Moisture balance-98.7 mm/mo -109–-88.9

Vapour deficit1,497 Pa 1,317–1,676

Wind speed2.40 m/s

Cloud cover11.5 % 6.10–16.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)