Dendrocalamus giganteus

Munro · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Dendrocalamus

At a glance

Occurrence records217

Data sources12

Biological traits15

DNA specimens11

eDNA detections8

Sources12 archives

Databases and archives Dendrocalamus giganteus's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility217 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF217 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB · GoaT1.7 Gbp

01Narrative

Dendrocalamus giganteus, commonly known as giant bamboo, is a giant tropical and subtropical, dense-clumping species native to Southeast Asia. It is one of the largest bamboo species in the world.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height30 m

Life cycle & reproduction4

Deciduousnessevergreen

Life formbamboo

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTdense secondary shrub and ruderal vegetation

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrocalamus giganteus has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes5

GenBank sequences10

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLOQ348051.1 ↗458 bp

ACGT

CTCCTCAGCCGGGGGTTCCGCCCGAAGAAGCAGGGGCTGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACTGATG …

Dendrocalamus giganteus ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL6★rbcLa★ITS★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Dendrocalamus giganteus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 667 490 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dendrocalamus giganteus1.67 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Ploidy6× hexaploid · measured

Chromosome records72–722n range72median72mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 725×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Ghorai, A. & A. Sharma. 1980. Cytotaxonomy of Indian Bambuseae II. Dendrocalameae and I Melocanneae. Acta Bot. Indica 134–138.

CCDB · book-ipcn73-74 — GOULD, F.W., & T.R. SODERSTROM. 1974. Chromosome numbers of some Ceylon grasses. Canad. J. Bot. 52: 1075-1090.

CCDB · book-indian_vol2 — Janaki Ammal (D. 1945) ; Gould, F.W. & Soderstrom, T.R. 1974

CCDB · book-atlas-flowering-plants — E.K.J.*

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

hexaploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type217 records

Wild obs. + sensor96

Museum / vouchered117

Cultivated / captive1

Other3

Origin

Introduced2

Range

Area of Occupancy AOO528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 46≤1 km 10≤10 km 10>10 km 8

74 georeferenced · 22 without coordinates

Open the mapobservation + sensor96

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 1≤1 km 2≤10 km 3>10 km 5

11 georeferenced · 106 without coordinates

Open the institutions mapphysical evidence117

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Southwest Forestry Collegelocation not on record	35
Kew, GB	13
Saint Louis, US	5
Berlin, DE	4
Beijing, CN	4
Antiguo Cuscatlán, SV	3
KMCClocation not on record	3
Gujarat Biodiversity Gene Banklocation not on record	3
Beijing, CN	3
Guangzhou, CN	2
Plocation not on record	2
Bronx, US	2
Nanjing, CN	2
UnBlocation not on record	2
Bando, JP	2
Seychelles National Herbariumlocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	2
Université de Strasbourglocation not on record	1
Ivano-Frankivsk, UA	1
Auckland, NZ	1
Durban, ZA	1
Taipei, TW	1
Madhya Pradesh Council of Science & Technologylocation not on record	1
St. Augustine, TT	1
Brasília, BR	1
Natural History Museum, Tribhuvan Universitylocation not on record	1
South Kensington, GB	1
UNESP-FCAlocation not on record	1
UTFPR-CPlocation not on record	1

30 institutions · 103 of 117 vouchered records shown · 14 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Dendrocalamus giganteus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 20.2–27.9

Seasonal swing summer↔winter11.5 °C

Max temp (day)29.8 °C 27.6–32.1

Min temp (night)17.8 °C 13.7–23.3

Precipitation33.8 mm/mo 7.40–50.5

Air humidity50.0 % 47.3–54.3

Moisture balance-105 mm/mo -110–-91.0

Vapour deficit1,479 Pa 1,252–1,711

Wind speed2.50 m/s 2.40–2.70

Cloud cover10.0 % 4.70–17.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)