Dendrobium thyrsiflorum

B.S.Williams · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records75

Data sources9

Biological traits6

DNA specimens18

eDNA detections18

Sources9 archives

Databases and archives Dendrobium thyrsiflorum's data was compiled from.

GBIFGlobal Biodiversity Information Facility75 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources6 traits

Chemical compositionNPASS27 compounds

Occurrence & distributionGBIF75 records

Environmental DNA1 datasets · 2 countries18 detections

DNA & barcodingBOLD · NCBI18 specimens

Genome at a glanceCCDB · GoaT · NCBI≈1.4 Gbp

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formepiphyte

03Chemical composition27 compounds

Compounds documented for Dendrobium thyrsiflorum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cinnamic acids and derivatives $ Phenylethanoids4

Iridoids monoterpenoids4

Dibenzylbutyrolactone lignans3

Flavonols3

Ursane and Taraxastane triterpenoids1

Documented compounds27 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	NPASS
(-)-Arctigenin	present	NPASS
(-)-Arctiin	present	NPASS
(1S,4aS,7S,7aS)-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-7-carboxylic acid	present	NPASS
(3aR,5aS,5bR,7aR,9S,11aR,11bR,13bS)-9-hydroxy-2,2,5a,5b,8,8,11a-heptamethyl-3,4,5,6,7,7a,9,10,11,11b,12,13b-dodecahydro-1H-cyclopenta[a]chrysene-3a-carboxylic acid	present	NPASS
7-O-methyl 4-O-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (1S,4aS,7S,7aS)-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4,7-dicarboxylate	present	NPASS
[(2R,3S,4R,5S,6S)-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-2-(hydroxymethyl)-4-[(2S,3R,4R,5S,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	NPASS
AAGCATAPYOEULE-XJMCYTIUSA-N	present	NPASS
Adoxosidic acid	present	NPASS
Astragalin	present	NPASS

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium thyrsiflorum has left across the world's sequence archives.

At a glance

DNA specimens18

Marker genes4

GenBank sequences10

eDNA detections18

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP068019.1 ↗251 bp

ACGT

AGCGTTATGTCGCTTCGTGTCAACTCCATCCCGTCGATGTATGGGCTGGCGAAGGCTCGGATGTGCAGAGTGGCTCATCGTGCCCCTCGG …

Dendrobium thyrsiflorum voucher ABRC1811QH2 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★ITS9★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Dendrobium thyrsiflorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 443 559 833 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dendrobium thyrsiflorum1.44 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome records40–402n range40median40mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 404×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Cheng, S. J., Z. H. Hu, X. L. Li & R. Y. Chen. 1985. A preliminary study on the chromosomes of Dendrobium in China. Acta Hort. Sin. 12(2): 119–124.

CCDB · ipcn-api-dl — Hashimoto, K. 1981. Chromosome count in Dendrobium I. 87 species. Bull. Hiroshima Bot. Gard. 4: 63–80.

CCDB · book-ipcn67-71 — KAMEMOTO, H . & R. SAGARIK. 1967. Chromosome numbers of Dendrobium species of Thailand. Amer. Orchid Soc. Bull. 36: 889-894.

CCDB · book-atlas-flowering-plants — Hoffmann 1930

n 201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Shekhar, N. & S. P. Vij. 1986. Cytotaxonomic studies in Dendrobium Sw. Pp. 121--135. In S.P. Vij (editor), Biology, Conservation, and Culture of Orchids. New Delhi, for Orchid Society of India, Affiliated East–West Press.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type75 records

Wild obs. + sensor21

Museum / vouchered53

Cultivated / captive1

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 7≤1 km 6≤10 km 1>10 km 3

17 georeferenced · 4 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 4

5 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence53

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	31
Kunming, CN	10
Bronx, US	3
Chongqing Museumlocation not on record	3
Moscow State Universitylocation not on record	1
Denver, US	1
Bangkok, TH	1

7 institutions · 50 of 53 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA18 detections

Where the DNA of Dendrobium thyrsiflorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.8 °C 19.0–20.6

Seasonal swing summer↔winter10.6 °C

Max temp (day)22.9 °C 22.1–23.7

Min temp (night)15.3 °C 14.9–15.7

Precipitation291 mm/mo 262–321

Air humidity63.4 % 61.6–65.3

Moisture balance175 mm/mo 132–218

Vapour deficit853 Pa 771–935

Wind speed1.20 m/s 1.00–1.40

Cloud cover48.8 % 48.0–49.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)