Dendrobium striolatum

Rchb.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records540

Data sources7

Biological traits30

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Dendrobium striolatum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility540 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF540 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 38

01Narrative

Dendrobium striolatum, commonly known as the streaked rock orchid is a species of orchid endemic to eastern Australia. It is a small, usually lithophytic orchid with wiry stems, cylindrical leaves and flowering stems with one or two yellow, cream-coloured or greenish flowers with reddish stripes. It often grows on cliff faces in New South Wales, Victoria and Tasmania.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology7

Leaf length65 mm

Leaf length max3 mm

Leaf length min2 mm

Leaf width2.5 mm

Leaf width max3 mm

Leaf width min2 mm

Seed mass0.002 mg

Life cycle & reproduction10

Dispersal typewind

Flowering endNov

Flowering startSep

Flowering timennnnnnnnyyyn

Life formepiphyte

Life spanperennial

Lifeform raunkiaer detailedlithophyte

Pollination syndromeinsect

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: Epiphyte

Leaf compoundnesssimple

Leaf shapeterete

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium striolatum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSON694119.1 ↗782 bp

ACGT

GTGACTCTGCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCA …

Dendrobium striolatum small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dendrobium striolatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidypolyploid inferred

Chromosome records38–762n range57median38mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 381×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — JONES, K., K. Y. Lim & P. J. Cribb. 1982. The chromosomes of orchids VII. Dendrobium. Kew Bull. 37: 221–227.

2n 761×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — JONES, K., K. Y. Lim & P. J. Cribb. 1982. The chromosomes of orchids VII. Dendrobium. Kew Bull. 37: 221–227.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type540 records

Wild obs. + sensor534

Museum / vouchered6

Range

Area of Occupancy AOO1 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 188≤1 km 88≤10 km 25>10 km 99

400 georeferenced · 134 without coordinates

Open the mapobservation + sensor534

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	1
Tampa, US	1
Universität Tübingenlocation not on record	1
Saint Louis, US	1
South Kensington, GB	1

5 institutions · 5 of 6 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)