Dendrobium plicatile

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records7

Data sources12

Biological traits8

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Dendrobium plicatile's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS · NPASS57 compounds

Occurrence & distributionGBIF7 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Dendrobium plicatile is an orchid species of Asia. It was formerly treated as Flickingeria fimbriata in the (no longer accepted) genus Flickingeria.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formpseudobulbous geophyte or epiphyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formherb

Woodinessnon-woody

03Chemical composition57 compounds

Compounds documented for Dendrobium plicatile across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Phenanthrenes14

Furofuranoid lignans8

Simple coumarins4

Germacrane sesquiterpenoids4

Eudesmane sesquiterpenoids3

Documented compounds57 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Cycloolivil	present	NPASS
(+)-Pinoresinol	present	LOTUS
(+)-Syringaresinol	present	LOTUS
(-)-(7'S,8S,8'R)-4,4'-dihydroxy-3,3',5,5'-tetramethoxy-7',9-epoxylignan-9'-ol-7-one	present	NPASS
(-)-Olivil	present	NPASS
(1S,3S,5R,8E,10S,11R)-10-hydroxy-3,8-dimethyl-12-methylidene-4,14-dioxatricyclo[9.3.0.03,5]tetradec-8-en-13-one	present	NPASS
(3aR,4S,5S,9E,11aR)-4,5-dihydroxy-10-methyl-3,6-dimethylidene-4,5,7,8,11,11a-hexahydro-3aH-cyclodeca[b]furan-2-one	present	NPASS
(3aS,4R,4aS,8R,8aR,9aS)-4,8-dihydroxy-5,8a-dimethyl-3-methylidene-4,4a,7,8,9,9a-hexahydro-3aH-benzo[f][1]benzofuran-2-one	present	NPASS
(3aS,4S,5E,9S,10E,11aS)-9-[[(3R,3aS,4R,5E,9E,11aS)-4-hydroxy-6,10-dimethyl-2-oxo-3a,4,7,8,11,11a-hexahydro-3H-cyclodeca[b]furan-3-yl]methyl]-4-hydroxy-6,10-dimethyl-3-methylidene-3a,4,7,8,9,11a-hexahydrocyclodeca[b]furan-2-one	present	NPASS
(3R,8S,9S,10R,13R,14S,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-4,7,8,9,11,12,14,15,16,17-decahydro-3H-cyclopenta[a]phenanthren-3-ol	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium plicatile has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences5

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKY966573.1 ↗640 bp

ACGT

TCGAGACCGAAATAAATATCGAGCGATTCGGCGAACAAGTGACATACGCGGCGGCGCCGATTGCCGTCCGGAAATAAAAATCCGCCCGAG …

Dendrobium plicatile voucher KFBG249 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dendrobium plicatile carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 381×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Hashimoto, K. 1981. Chromosome count in Dendrobium I. 87 species. Bull. Hiroshima Bot. Gard. 4: 63–80.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type7 records

Wild obs. + sensor3

Museum / vouchered4

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 2

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	1
Moscow State Universitylocation not on record	1

2 institutions · 2 of 4 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Dendrobium plicatile was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.8 °C

Min temp (night)3.60 °C

Precipitation10.4 mm/mo

Air humidity48.1 %

Moisture balance-73.1 mm/mo

Vapour deficit636 Pa

Wind speed4.20 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)