Dendrobium moschatum

(Banks) Sw. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records71

Data sources10

Biological traits12

DNA specimens37

eDNA detections37

Sources10 archives

Databases and archives Dendrobium moschatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility71 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF71 records

Environmental DNA1 datasets · 2 countries37 detections

DNA & barcodingBOLD · NCBI37 specimens

Genome at a glanceCCDB · GoaT1.8 Gbp

01Narrative

杓唇石斛（学名：），为兰科石斛属下的一个植物种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass0.007 mg

Life cycle & reproduction2

Life formepiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 000 m

Elevation min500 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Woodinessnon-woody

03Chemical composition2 compounds

Compounds documented for Dendrobium moschatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Phenanthrenes1

Monomeric stilbenes1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Moscatilin		present	LOTUS
Moscatin		present	LOTUS

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium moschatum has left across the world's sequence archives.

At a glance

DNA specimens37

Marker genes4

GenBank sequences10

eDNA detections37

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPP516855.1 ↗707 bp

ACGT

CCGGGGGGAGTATTGTCGAGACGAATATATCGAGCGATCTTGAGAACCTATCAAAATAAGCGGTGGGTATTGCTGCTGCAAATAAAATTC …

Dendrobium moschatum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL6★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Dendrobium moschatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 760 400 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dendrobium moschatum1.76 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidy2× diploid · measured

Chromosome records38–402n range38median38mode13records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 3810×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-indian_vol2 +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Shekhar, N. & S. P. Vij. 1986. Cytotaxonomic studies in Dendrobium Sw. Pp. 121--135. In S.P. Vij (editor), Biology, Conservation, and Culture of Orchids. New Delhi, for Orchid Society of India, Affiliated East–West Press.

CCDB · ipcn-api-dl — Hashimoto, K. 1987. Karyomorphological studies of some 80 taxa of Dendrobium, Orchidaceae. Bull. Hiroshima Bot. Gard. 9: 1–186.

CCDB · ipcn-api-dl — Sultana, P. & M. A. Zaman. 1994. Karyotype studies of four Dendrobium species from Bangladesh. Bangladesh J. Bot. 23(2): 187–192.

CCDB · ipcn-api-dl — Hashimoto, K. 1981. Chromosome count in Dendrobium I. 87 species. Bull. Hiroshima Bot. Gard. 4: 63–80.

CCDB · book-indian_vol2 — Vij, S.P., Gupta, G.C. & Garg, A.K. 1976

CCDB · kew — Narayan RKJ, Parida A, Vij SP. 1989. DNA variation in Orchidaceae. Nucleus 32: 71-75.

CCDB · Cave1963 — Chardard 1963

2n 403×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-indian_vol2

CCDB · ipcn-api-dl — Sau, H. & A. K. Sharma. 1983. Chromosome evolution and affinity of certain genera of Orchidaceae. Cytologia 48: 363–372.

CCDB · book-ipcn75-78 — Sharma 1970

CCDB · book-indian_vol2 — Banerjee, M. & Chaudhuri, M. 1971

n 192×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Vij et al. 1976

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type71 records

Wild obs. + sensor40

Museum / vouchered29

Cultivated / captive2

Range

Area of Occupancy AOO212 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 7≤1 km 1≤10 km 3>10 km 9

20 georeferenced · 20 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 3≤10 km 1

4 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence29

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	7
Beijing, CN	2
Université de Bordeauxlocation not on record	2
Paris, FR	1
UnBlocation not on record	1
Chongqing Museumlocation not on record	1
Lake Charles, US	1

7 institutions · 15 of 29 vouchered records shown · 11 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA37 detections

Where the DNA of Dendrobium moschatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 11.3–16.9

Seasonal swing summer↔winter12.7 °C

Max temp (day)19.2 °C 16.4–19.2

Min temp (night)12.0 °C 4.90–13.6

Precipitation330 mm/mo 77.0–902

Air humidity66.2 % 49.8–75.6

Moisture balance209 mm/mo

Vapour deficit633 Pa 468–789

Wind speed1.00 m/s 0.8–3.80

Cloud cover44.7 % 28.3–46.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)