Dendrobium kingianum

Bidwill ex Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records1 070

Data sources10

Biological traits22

DNA specimens6

eDNA detections8

Sources10 archives

Databases and archives Dendrobium kingianum's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 070 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF1 070 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 76

01Narrative

Dendrobium kingianum, commonly known as the pink rock orchid, is a flowering plant in the orchid family Orchidaceae and is endemic to eastern Australia. It usually grows on rocks, rarely as an epiphyte, and has thin, spreading leaves and spikes of up to fifteen, usually pink flowers in late winter to spring. It is popular in Australian native horticulture and is a commonly cultivated orchid among Australian orchid species growers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology6

Leaf length75 mm

Leaf length max100 mm

Leaf length min30 mm

Leaf width17.5 mm

Leaf width max20 mm

Leaf width min10 mm

Life cycle & reproduction5

Deciduousnessevergreen

Flowering timennnnnnnyyynn

Life formpseudobulbous epiphyte

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteobligatory

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: Epiphyte

Leaf compoundnesssimple

Leaf shapenarrowly_elliptical narrowly_obovate

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium kingianum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences10

eDNA detections8

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMW521087.1 ↗608 bp

ACGT

CGTGAGATACGCGGCGGCGATTGCCGTCGTAAGATAAAAAGCCGTCCCGGTCGTCGCCTCATCCCCTTTCGGGGCGGGGGCACGGCGAAG …

Dendrobium kingianum clone Glocester_PA8 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS7

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dendrobium kingianum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 76 n = 38

Ploidydiploid inferred

Chromosome records40–762n range58median76mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 401×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Solovjova. 2003. Homology of karyotypes of species and genera in a natural family. In Actual Problems of Genetics. Proceedings of the 2nd Conference of the Moscow Society of Genetics and Breeders named after Academician N. I. Vavilov, 2: 331--333, Moscow.

2n 761×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Hashimoto, K. 1981. Chromosome count in Dendrobium I. 87 species. Bull. Hiroshima Bot. Gard. 4: 63–80.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 070 records

Wild obs. + sensor888

Museum / vouchered152

Cultivated / captive30

Origin

Native33

Introduced9

Range

Area of Occupancy AOO2 964 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 334≤1 km 60≤10 km 39>10 km 391

824 georeferenced · 64 without coordinates

Open the mapobservation + sensor888

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 9≤1 km 17≤10 km 87>10 km 4

117 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence152

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy20% within 1 km

≤1 km 6≤10 km 24

30 georeferenced

Open the mapnot free-living30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	54
Mount Annan, AU	38
Museo Entomologico de Leonlocation not on record	19
Adelaide, AU	9
Armidale, AU	9
Smithfield, AU	8
Brisbane, AU	5
Christchurch, NZ	2
Vancouver, CA	1
Denver, US	1
Chongqing Museumlocation not on record	1
Madison, US	1

12 institutions · 148 of 152 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Dendrobium kingianum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.7 °C 26.7–26.7

Seasonal swing summer↔winter18.4 °C

Max temp (day)33.5 °C

Min temp (night)19.2 °C

Precipitation18.5 mm/mo

Air humidity39.9 %

Moisture balance-192 mm/mo

Vapour deficit2,106 Pa

Wind speed4.30 m/s

Cloud cover15.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dendrobium kingianum

At a glance

Sources10 archives

Size & morphology6

Life cycle & reproduction5

Diet & foraging1

Habitat & environment10

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 070 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 070 records