Dendrobium jenkinsii

Wall. ex Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records73

Data sources8

Biological traits9

DNA specimens24

eDNA detections24

Sources8 archives

Databases and archives Dendrobium jenkinsii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility73 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF73 records

Environmental DNA1 datasets · 2 countries24 detections

DNA & barcodingBOLD · NCBI24 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Dendrobium jenkinsii Wall. ex Lindl., 1839 è una pianta della famiglia delle Orchidacee.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte or lithophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatesubtropical

Climberself-supporting

Elevation max1 400 m

Elevation min1 100 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Woodinessnon-woody

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium jenkinsii has left across the world's sequence archives.

At a glance

DNA specimens24

Marker genes4

GenBank sequences10

eDNA detections24

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOP738579.1 ↗249 bp

ACGT

AGCATTACGTCGCTCCCTGTCAACTCCATCCCTTCTTTTGATGGGCTGGTAAAAGGCTCGGACGTGTAAAGTGGCTCGTCGTGCCCCTCA …

Dendrobium jenkinsii isolate ZG59 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS8★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dendrobium jenkinsii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 381×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Hashimoto, K. 1982. Chromosome count in Dendrobium II. 30 species. Bull. Hiroshima Bot. Gard. 5: 80–87.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type73 records

Wild obs. + sensor27

Museum / vouchered44

Cultivated / captive2

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 2≤1 km 3≤10 km 6>10 km 3

14 georeferenced · 13 without coordinates

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 44 records without

Open the institutions mapphysical evidence44

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	15
Kunming, CN	10
Guangzhou, CN	8
Harvard Universitylocation not on record	2
Servico de Microbiologia e Imunologialocation not on record	2
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	1
Bronx, US	1
Vietnam Academy of Science and Technology (VAST)location not on record	1
Saint Louis, US	1

9 institutions · 41 of 44 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA24 detections

Where the DNA of Dendrobium jenkinsii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 11.5–23.3

Seasonal swing summer↔winter21.5 °C

Max temp (day)21.2 °C 16.8–25.6

Min temp (night)12.4 °C 5.00–19.8

Precipitation267 mm/mo 64.5–470

Air humidity57.1 % 48.0–66.2

Moisture balance145 mm/mo -47.2–337

Vapour deficit904 Pa 843–964

Wind speed3.00 m/s 1.90–4.20

Cloud cover29.8 % 25.3–34.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)