Dendrobium heterocarpum

Wall. ex Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records79

Data sources10

Biological traits10

DNA specimens21

eDNA detections21

Sources10 archives

Databases and archives Dendrobium heterocarpum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility79 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF79 records

Environmental DNA1 datasets · 1 countries21 detections

DNA & barcodingBOLD · NCBI21 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Dendrobium heterocarpum, commonly known as 尖刀唇石斛 (jian dao chun shi hu), is a species of orchid that is native to the China, Nepal, Bhutan, Assam, the Indian subcontinent and Southeast Asia.Sittisujjatham, S. (2006). Wild Orchid of Thailand 1: 1-495. Amarin.Lucksom, S.Z. (2007). The orchids of Sikkim and North East Himalaya: 1-984. S.Z.Lucksom, India.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max0.3 m

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Elevation max1 800 m

Elevation min1 300 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Woodinessnon-woody

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium heterocarpum has left across the world's sequence archives.

At a glance

DNA specimens21

Marker genes4

GenBank sequences10

eDNA detections21

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP738573.1 ↗245 bp

ACGT

AGCATTTTATCGCTCCGTGCCTAGTCTCCCATCCATGGATGTGTTGCTAAGGCTCGGATGTGCATGGTGGCTCGTCGTGCGCCTTAGTGC …

Dendrobium heterocarpum isolate ZG53 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL4★ITS6★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dendrobium heterocarpum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome records36–402n range38median38mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 389×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2

CCDB · book-ipcn65 — Pancho 1965a

CCDB · ipcn-api-dl — JONES, K., K. Y. Lim & P. J. Cribb. 1982. The chromosomes of orchids VII. Dendrobium. Kew Bull. 37: 221–227.

CCDB · ipcn-api-dl — Hashimoto, K. 1987. Karyomorphological studies of some 80 taxa of Dendrobium, Orchidaceae. Bull. Hiroshima Bot. Gard. 9: 1–186.

CCDB · ipcn-api-dl — Vijayakumar, N. & D. Subramanian. 1994. Karyomorphological studies of Orchidaceae from Tamilnadu. Cell Chromosome Res. 17(1): 40–47.

CCDB · ipcn-api-dl — Hashimoto, K. 1981. Chromosome count in Dendrobium I. 87 species. Bull. Hiroshima Bot. Gard. 4: 63–80.

CCDB · book-ipcn67-71 — KAMEMOTO, H . & R. SAGARIK. 1967. Chromosome numbers of Dendrobium species of Thailand. Amer. Orchid Soc. Bull. 36: 889-894.

CCDB · book-ipcn67-71 — WILFRET, G.J., & H. KAMEMOTO. 1971. Genome and karyotype relationship in the genus Dendrobium (Orchidaceael II. Karyotype relationships. Cytologia 36: 604-613.

CCDB · book-ipcn73-74 — BANERJI, M. , M. CHAUDHURI. 1972. Further studies on chromosomes of some Orchidaceae and Iridaceae from the temperate Himalayas. Proc. Indian Sci. Congr. Assoc. 59(III): 347.

CCDB · book-indian_vol2 — Kosaki, K. 1958 (Duncan, R.E. 1959).; Vajrabhaya, T. & Randolph, L.F. 1960 ; Kosaki, K. & Kamemoto, H. 1961 ; Jones, K. 1963 ; Pancho, J.V. 1965a ; Kamemoto, H. & Sagarik, R. 1967 ; Wilfret, G.J. & Kamemoto, H. 1971 ; Banerji, M. & Chaudhuri, M. 1972

2n 361×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Sharma 1970

2n 401×CCDB · book-indian_vol2

CCDB · book-indian_vol2 — Mehra, P.N. & Sehgal, R.N. 1976

n 201×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Mehra & Sehgal 1976

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type79 records

Wild obs. + sensor51

Museum / vouchered28

Range

Area of Occupancy AOO240 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 7≤1 km 10≤10 km 7>10 km 16

40 georeferenced · 11 without coordinates

Open the mapobservation + sensor51

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	5
South Kensington, GB	3
Kunming, CN	1
Harvard Universitylocation not on record	1
Kathmandu, NP	1
Chicago, US	1
Saint Louis, US	1
Natural History Museum, Tribhuvan Universitylocation not on record	1

8 institutions · 14 of 28 vouchered records shown · 13 without an institution code

09Environmental DNA21 detections

Where the DNA of Dendrobium heterocarpum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.1 °C 28.1–28.1

Seasonal swing summer↔winter4.40 °C

Max temp (day)31.9 °C

Min temp (night)23.6 °C

Precipitation137 mm/mo

Air humidity59.8 %

Moisture balance-8.90 mm/mo

Vapour deficit1,523 Pa

Wind speed2.20 m/s

Cloud cover38.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)