Dendrobium gracilicaule

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records1 080

Data sources8

Biological traits26

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Dendrobium gracilicaule's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 080 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF1 080 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Dendrobium gracilicaule adalah spesies tumbuhan yang tergolong ke dalam famili Orchidaceae. Spesies ini juga merupakan bagian dari ordo Asparagales. Spesies Dendrobium gracilicaule sendiri merupakan bagian dari genus Dendrobium. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh F.Muell..

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology6

Leaf length100 mm

Leaf length max130 mm

Leaf length min50 mm

Leaf width30 mm

Leaf width max40 mm

Leaf width min20 mm

Life cycle & reproduction8

Deciduousnessevergreen

Flowering endSep

Flowering startJul

Flowering timennnnnnyyynnn

Life formpseudobulbous epiphyte or lithophyte

Life spanperennial

Lifeform raunkiaer detailedlithophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteobligatory

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: Epiphyte

Habitat GIFTrain forest, dry forest

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium gracilicaule has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSEU430382.1 ↗715 bp

ACGT

GTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAATATATCGAGCGATTCGGAGAACCCGTGAGATACGCGACGGCAATTGCCGTC …

Dendrobium gracilicaule 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dendrobium gracilicaule carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 381×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — JONES, K., K. Y. Lim & P. J. Cribb. 1982. The chromosomes of orchids VII. Dendrobium. Kew Bull. 37: 221–227.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 080 records

Wild obs. + sensor864

Museum / vouchered206

Cultivated / captive8

Other2

Origin

Native27

Introduced8

Range

Area of Occupancy AOO3 320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 491≤1 km 33≤10 km 45>10 km 267

836 georeferenced · 28 without coordinates

Open the mapobservation + sensor864

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 8≤1 km 8≤10 km 144>10 km 12

172 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence206

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy13% within 1 km

≤1 km 1≤10 km 7

8 georeferenced

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	78
Mount Annan, AU	35
Canberra, AU	25
Smithfield, AU	20
Université de Strasbourglocation not on record	10
Museo Entomologico de Leonlocation not on record	9
Armidale, AU	7
Adelaide, AU	6
South Kensington, GB	4
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Paris, FR	1
James Cook Townsvillelocation not on record	1
Hobart, AU	1
Zürich, CH	1
Christchurch, NZ	1
QVMAGlocation not on record	1
Saint Louis, US	1

17 institutions · 204 of 206 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Dendrobium gracilicaule was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Dendrobium gracilicaule

At a glance

Sources8 archives

Size & morphology6

Life cycle & reproduction8

Diet & foraging1

Habitat & environment11

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 080 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 080 records