Dendrobium gibsonii

Paxton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records14

Data sources10

Biological traits9

DNA specimens6

eDNA detections6

Sources10 archives

Databases and archives Dendrobium gibsonii's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionNPASS23 compounds

Occurrence & distributionGBIF14 records

Environmental DNA1 datasets · 0 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Dendrobium gibsonii is a species of orchid native to China (Guangxi and Yunnan provinces), the Himalayas (Nepal, Bhutan, India, Assam), and northern Indochina (Myanmar, Thailand, Laos, Vietnam).Kew World Checklist of Selected Plant FamiliesFlora of China v 25 p 387, 曲轴石斛 qu zhou shi hu, Dendrobium gibsonii Lindley, Paxton’s Mag. Bot. 5: 169. 1838.Lucksom, S.Z. (2007). The orchids of Sikkim and North East Himalaya: 1-984. S.Z.Lucksom, India.Raskoti, B.B. (2009). The Orchids of Nepal: 1-252. Bhakta Bahadur Raskoti and Rita Ale.Sittisujjatham, S. (2009). Wild Orchid of Thailand 2: 1-463. Amarin.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Elevation max1 700 m

Elevation min1 000 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Woodinessnon-woody

03Chemical composition23 compounds

Compounds documented for Dendrobium gibsonii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Pregnane steroids10

m-Terphenyls2

Documented compounds23 total

Tissue Source Quantified only

Compound	Amount	Source
2',4'-Dihydroxyacetophenone	present	NPASS
2-Acetylhydroquinone	present	NPASS
3',4-Diacetyl-2,2',3,6'-tetrahydroxy-biphenyl	present	NPASS
4'-Hydroxyacetophenone	present	NPASS
[(1R)-1-[(1R,2S)-2-[(1S)-1-acetyloxyethyl]-2-hydroxy-1-methyl-5-oxocyclopentyl]-2-[(1R,6S,8aR)-6-[(2R,4S,5R,6R)-5-[(2S,4S,5R,6S)-5-[(2S,4S,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-8a-methyl-2-oxo-1,3,5,6,7,8-hexahydronaphthalen-1-yl]ethyl] (E)-3-phenylprop-2-enoate	present	NPASS
[(1S)-1-[(3S,8S,9R,10R,12R,13R,14R,17S)-8,14,17-trihydroxy-3-[(2R,4S,5R,6R)-5-[(2S,4R,5R,6R)-5-[(2S,4R,5R,6R)-5-[(2S,4S,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-12-[(E)-3-phenylprop-2-enoyl]oxy-1,2,3,4,7,9,11,12,15,16-decahydrocyclopenta[a]phenanthren-17-yl]ethyl] pyridine-3-carboxylate	present	NPASS
[(1S)-1-[(3S,8S,9R,10R,12R,13R,14R,17S)-8,14,17-trihydroxy-3-[(2R,4S,5R,6R)-5-[(2S,4R,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-12-[(E)-3-phenylprop-2-enoyl]oxy-1,2,3,4,7,9,11,12,15,16-decahydrocyclopenta[a]phenanthren-17-yl]ethyl] pyridine-3-carboxylate	present	NPASS
[(1S)-1-[(3S,8S,9R,10R,12R,13R,14R,17S)-8,14,17-trihydroxy-3-[(2R,4S,5S,6R)-4-hydroxy-5-[(2S,4R,5R,6R)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-12-[(E)-3-phenylprop-2-enoyl]oxy-1,2,3,4,7,9,11,12,15,16-decahydrocyclopenta[a]phenanthren-17-yl]ethyl] 3-methylbutanoate	present	NPASS
[(3S,8S,9R,10R,12R,13S,14R,17S)-17-acetyl-8,14,17-trihydroxy-3-[(2R,4S,5R,6R)-4-methoxy-5-[(2S,4S,5R,6S)-4-methoxy-5-[(2S,4S,5R,6R)-4-methoxy-5-[(2S,4R,5S,6S)-4-methoxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-1,2,3,4,7,9,11,12,15,16-decahydrocyclopenta[a]phenanthren-12-yl] (E)-3-phenylprop-2-enoate	present	NPASS
[(3S,8S,9R,10R,12R,13S,14R,17S)-17-acetyl-8,14,17-trihydroxy-3-[(2R,4S,5S,6R)-4-hydroxy-5-[(2S,4R,5R,6R)-5-[(2S,4R,5S,6S)-5-[(2S,4S,5R,6R)-5-[(2S,4R,5S,6S)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-4-methoxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-1,2,3,4,7,9,11,12,15,16-decahydrocyclopenta[a]phenanthren-12-yl] (E)-3,4-dimethylpent-2-enoate	present	NPASS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium gibsonii has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences10

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKJ658305.1 ↗247 bpChina

ACGT

AGCGTTACGTCACTCCGTGTCAAGTCATCCCATCGATGGATGGGCTGGCGAGTGCTCGGATGTGCAGAGTGGCTCCTCGTGCCCCTCGGC …

Dendrobium gibsonii voucher D-HZ010 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS8★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dendrobium gibsonii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome records38–402n range38median38mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 384×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-indian_vol2

CCDB · ipcn-api-dl — Cheng, S. J., Z. H. Hu, X. L. Li & R. Y. Chen. 1985. A preliminary study on the chromosomes of Dendrobium in China. Acta Hort. Sin. 12(2): 119–124.

CCDB · ipcn-api-dl — Shekhar, N. & S. P. Vij. 1986. Cytotaxonomic studies in Dendrobium Sw. Pp. 121--135. In S.P. Vij (editor), Biology, Conservation, and Culture of Orchids. New Delhi, for Orchid Society of India, Affiliated East–West Press.

CCDB · book-ipcn75-78 — Sharma 1970

CCDB · book-indian_vol2 — Vajrabhaya, T. & Randolph, L.F. 1960 ; Banerjee, M. & Chaudhuri, M. 1971 ; Vij, S.P. & Mehra, P.N. 1976

2n 402×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sau, H. & A. K. Sharma. 1983. Chromosome evolution and affinity of certain genera of Orchidaceae. Cytologia 48: 363–372.

CCDB · ipcn-api-dl — Hashimoto, K. 1982. Chromosome count in Dendrobium II. 30 species. Bull. Hiroshima Bot. Gard. 5: 80–87.

n 191×CCDB · ipcn-api-dl

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~36.3 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin36.3 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type14 records

Wild obs. + sensor1

Museum / vouchered13

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 12 without coordinates

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	3
Saint Louis, US	2
South Kensington, GB	2
BMlocation not on record	1
Beijing, CN	1

5 institutions · 9 of 13 vouchered records shown · 4 without an institution code

09Environmental DNA6 detections

Where the DNA of Dendrobium gibsonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)