Dendrobium formosum

Roxb. ex Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records17

Data sources12

Biological traits6

DNA specimens3

eDNA detections3

Sources12 archives

Databases and archives Dendrobium formosum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Chemical compositionLOTUS12 compounds

Occurrence & distributionGBIF17 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT880 Mbp

01Narrative

Dendrobium formosum (beautiful giant-flowered dendrobium) is a species of orchid. It is native to the Himalayas (Nepal, Bhutan, Assam, India, Bangladesh), northern Indochina (Thailand, Myanmar, Vietnam) and the Andaman Islands, and widely cultivated elsewhere as an ornamental.Kew World Checklist of Selected Plant FamiliesHossain, A.B.M. (2002). A Taxonomic report on the genus Dendrobium Sw.. Bangladesh Journal of Plant Taxonomy 9(2): 47-55.Misra, S. (2004). Orchids of Orissa: 1-774. Bishen Singh Mahendra Pal Singh, Dehra Dun.Lucksom, S.Z. (2007). The orchids of Sikkim and North East Himalaya: 1-984. S.Z.Lucksom, IndiaPandey, R.P. & Dilwakar, P.G. (2008). An integrated check-list flora of Andaman and Nicobar islands, India. Journal of Economic and Taxonomic Botany 32: 403-500.Raskoti, B.B. (2009). The Orchids of Nepal: 1-252. Bhakta Bahadur Raskoti and Rita Ale. It is the emblem of Ranong Province in Thailand.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatewet tropical

Climberself-supporting

Epiphyteobligatory

Growth formepiphyte

03Chemical composition12 compounds

Compounds documented for Dendrobium formosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Phenanthrenes7

Monomeric stilbenes3

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
4-Methoxy-9,10-Dihydrophenanthrene-2,7-Diol	present	LOTUS
5-(2-(3-Hydroxy-5-methoxyphenyl)ethyl)-2-methoxyphenol	present	LOTUS
5-Methoxy-7-hydroxy-9,10-dihydro-1,4-phenanthrenequinone	present	LOTUS
5-Methoxy-9,10-dihydrophenanthrene-2,4,7-triol	present	LOTUS
Batatasin Iii	present	LOTUS
Confusarin	present	LOTUS
Dihydroconiferyldihydro-p-coumarate	present	LOTUS
Erianthridin	present	LOTUS
Hircinol	present	LOTUS
Lusianthridin	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium formosum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKY966543.1 ↗637 bp

ACGT

TCGAGACCGGAATACATCGAGCGATTTGGAGAACCCGTCAAAATAAGCGGTGGCTATTGCTGCCGCGATAAAATCCATCCCAATCGTTGC …

Dendrobium formosum voucher KFBG2617A internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★ITS5

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Dendrobium formosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size880 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dendrobium formosum0.88 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidy2× diploid · measured

Chromosome records38–402n range38median38mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 383×CCDB · ipcn-api-dl · CCDB · book-indian_vol2 · CCDB · Cave1963

CCDB · ipcn-api-dl — Shekhar, N. & S. P. Vij. 1986. Cytotaxonomic studies in Dendrobium Sw. Pp. 121--135. In S.P. Vij (editor), Biology, Conservation, and Culture of Orchids. New Delhi, for Orchid Society of India, Affiliated East–West Press.

CCDB · book-indian_vol2 — Ito, I. & Mutsuura, O. 1957 (Duncan, R.E. 1959); K~saki, K. & Kamemoto, H. 1961 ; Shindo, K. & Kamemoto, H. 1963b; Banerji, M. & Chaudhuri, M. 1972

CCDB · Cave1963 — Shindo & Kam. 1963b

2n 402×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Jones WE, Kuehnle AR, Arumuganathan K. 1998. Nuclear DNA content of 26 Orchid (Orchidaceae) genera with emphasis on Dendrobium. Annals of Botany 82: 189-194.

n 191×CCDB · ipcn-api-dl

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type17 records

Wild obs. + sensor11

Museum / vouchered6

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 4≤1 km 2≤10 km 1>10 km 1

8 georeferenced · 3 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 3≤10 km 1

4 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	5
Bronx, US	1

2 institutions · 6 of 6 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Dendrobium formosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)