Dendrobium fimbriatum

Hook. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Dendrobium

At a glance

Occurrence records113

Data sources12

Biological traits10

DNA specimens44

eDNA detections44

Sources12 archives

Databases and archives Dendrobium fimbriatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility113 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI44 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics44 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS · NPASS81 compounds

Occurrence & distributionGBIF113 records

Environmental DNA1 datasets · 2 countries44 detections

DNA & barcodingBOLD · NCBI44 specimens

Genome at a glanceCCDB3 Gbp

01Narrative

Dendrobium fimbriatum Hook., 1823 è una pianta della famiglia delle Orchidacee.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formpseudobulbous epiphyte or lithophyte

Lifeform raunkiaer detailedlithophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatesubtropical

Climberself-supporting

Elevation max3 700 m

Elevation min300 m

Epiphytefacultative

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Woodinessnon-woody

03Chemical composition81 compounds

Compounds documented for Dendrobium fimbriatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Monomeric stilbenes29

Phenanthrenes10

Stigmastane steroids5

Flavanones4

Simple phenolic acids3

Documented compounds81 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Syringaresinol	present	NPASS
(-)-Syringaresinol	present	NPASS
(17R)-13,17-dihydroxy-5-methoxy-4,7,12-trimethyl-2,10,16-trioxatetracyclo[9.7.0.03,8.014,18]octadeca-1(11),3(8),4,6,12,14(18)-hexaene-9,15-dione	present	NPASS
(1R,2S,4S,5'R,6R,7S,8S,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-4,8,16-triol	present	LOTUS
(7aR)-6-hydroxy-4,4,7a-trimethyl-6,7-dihydro-5H-1-benzofuran-2-one	present	NPASS
(R)-naringenin	present	NPASS
(S)-Naringenin	present	NPASS
2,3,4,7-Tetramethoxyphenanthrene	present	NPASS
2,4,7-Trihydroxy-9,10-dihydrophenanthrene	present	NPASS
2-[[2-Hydroxy-6-[2-(4-hydroxy-3-methoxyphenyl)ethyl]-4-methoxyphenyl]methyl]-3-[2-(4-hydroxy-3-methoxyphenyl)ethyl]-5-methoxyphenol	present	LOTUS

05DNA & barcoding44 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Dendrobium fimbriatum has left across the world's sequence archives.

At a glance

DNA specimens44

Marker genes4

GenBank sequences10

eDNA detections44

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPQ394614.1 ↗598 bpIndia · 2024

ACGT

GAACCCATCAAAATAAGCGGTGGCCGCTGCTGCTGCGAAAAAGATCCAGCCCAGTCGTCGCCTCGCCCCAGCCTTGGGGCGGGGACCCGA …

Dendrobium fimbriatum voucher ANUBH1792 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Dendrobium fimbriatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 031 800 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Dendrobium fimbriatum3.03 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidy2× diploid · measured

Chromosome records38–402n range38median38mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 387×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +1

CCDB · ipcn-api-dl — Shekhar, N. & S. P. Vij. 1986. Cytotaxonomic studies in Dendrobium Sw. Pp. 121--135. In S.P. Vij (editor), Biology, Conservation, and Culture of Orchids. New Delhi, for Orchid Society of India, Affiliated East–West Press.

CCDB · ipcn-api-dl — Mehra, P. N. & R. N. Sehgal. 1980. In IOPB chromosome number reports LXVII. Taxon 29: 348–350.

CCDB · ipcn-api-dl — Hashimoto, K. 1981. Chromosome count in Dendrobium I. 87 species. Bull. Hiroshima Bot. Gard. 4: 63–80.

CCDB · book-ipcn67-71 — KAMEMOTO, H . & R. SAGARIK. 1967. Chromosome numbers of Dendrobium species of Thailand. Amer. Orchid Soc. Bull. 36: 889-894.

CCDB · book-ipcn75-78 — Vij et al. 1976

CCDB · book-indian_vol2 — Vij, S.P., Gupta, G.C. & Garg, A.K. 1976

2n 403×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Cheng, S. J., Z. H. Hu, X. L. Li & R. Y. Chen. 1985. A preliminary study on the chromosomes of Dendrobium in China. Acta Hort. Sin. 12(2): 119–124.

CCDB · ipcn-api-dl — Sau, H. & A. K. Sharma. 1983. Chromosome evolution and affinity of certain genera of Orchidaceae. Cytologia 48: 363–372.

CCDB · book-ipcn75-78 — Sharma 1970

n 191×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Mehra, P. N. & S. K. Kashyap. 1989. Cytol. Orchids North-W. Himalayas Pramodh P. Kapur at Raj Bandhu Industrial Co., New Delhi.

n 201×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — ARORA, C.M. 1971. In IOPB chromsome number reports XXXIV. Taxon 20: 785-797.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type113 records

Wild obs. + sensor45

Museum / vouchered65

Cultivated / captive3

Range

Area of Occupancy AOO304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 7≤1 km 4≤10 km 7>10 km 9

27 georeferenced · 18 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 4

4 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence65

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	25
Kunming, CN	8
Guilin, CN	8
South Kensington, GB	3
Denver, US	2
Bronx, US	1
Paris, FR	1
Chongqing Museumlocation not on record	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1

9 institutions · 50 of 65 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA44 detections

Where the DNA of Dendrobium fimbriatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found44

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 44 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 10.0–21.2

Seasonal swing summer↔winter11.8 °C

Max temp (day)19.2 °C 15.7–27.6

Min temp (night)9.90 °C 3.10–15.5

Precipitation34.3 mm/mo 13.8–246

Air humidity51.8 % 45.7–62.0

Moisture balance-80.1 mm/mo -95.2–114

Vapour deficit827 Pa 711–1,172

Wind speed3.30 m/s 1.50–4.50

Cloud cover32.1 % 24.1–42.1

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)